ID: 1176845966

View in Genome Browser
Species Human (GRCh38)
Location 21:13876817-13876839
Sequence ATGTAGAAGCAGATTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176845966_1176845969 10 Left 1176845966 21:13876817-13876839 CCCTTCTGAATCTGCTTCTACAT No data
Right 1176845969 21:13876850-13876872 TTTGCCACAGCCTGGCAATGTGG No data
1176845966_1176845971 16 Left 1176845966 21:13876817-13876839 CCCTTCTGAATCTGCTTCTACAT No data
Right 1176845971 21:13876856-13876878 ACAGCCTGGCAATGTGGTAAAGG No data
1176845966_1176845968 2 Left 1176845966 21:13876817-13876839 CCCTTCTGAATCTGCTTCTACAT No data
Right 1176845968 21:13876842-13876864 TCACTATCTTTGCCACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176845966 Original CRISPR ATGTAGAAGCAGATTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr