ID: 1176848611

View in Genome Browser
Species Human (GRCh38)
Location 21:13895601-13895623
Sequence AAAGATGCACAGCTACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176848611_1176848616 11 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848616 21:13895635-13895657 GGAGCTGGAGCTGGAGCTGCAGG 0: 22
1: 26
2: 68
3: 356
4: 1762
1176848611_1176848618 19 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848618 21:13895643-13895665 AGCTGGAGCTGCAGGGATGCAGG 0: 25
1: 47
2: 177
3: 665
4: 1726
1176848611_1176848617 12 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848617 21:13895636-13895658 GAGCTGGAGCTGGAGCTGCAGGG 0: 19
1: 19
2: 47
3: 227
4: 1074
1176848611_1176848614 -4 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848614 21:13895620-13895642 CTTTCAGTCATGGCTGGAGCTGG No data
1176848611_1176848615 2 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848615 21:13895626-13895648 GTCATGGCTGGAGCTGGAGCTGG No data
1176848611_1176848613 -10 Left 1176848611 21:13895601-13895623 CCAAGCTGTAGCTGTGCATCTTT No data
Right 1176848613 21:13895614-13895636 GTGCATCTTTCAGTCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176848611 Original CRISPR AAAGATGCACAGCTACAGCT TGG (reversed) Intergenic
No off target data available for this crispr