ID: 1176851607

View in Genome Browser
Species Human (GRCh38)
Location 21:13921772-13921794
Sequence TTTTCACTGAGGAAAGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176851604_1176851607 25 Left 1176851604 21:13921724-13921746 CCAGGTGGAAAGAGGATCTGTGA No data
Right 1176851607 21:13921772-13921794 TTTTCACTGAGGAAAGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176851607 Original CRISPR TTTTCACTGAGGAAAGCTGG CGG Intergenic
No off target data available for this crispr