ID: 1176856800

View in Genome Browser
Species Human (GRCh38)
Location 21:13980741-13980763
Sequence CCCAACCCGCTCCCCACGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176856789_1176856800 14 Left 1176856789 21:13980704-13980726 CCCGCCGTGAATAGTGCAGCCAC No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data
1176856788_1176856800 15 Left 1176856788 21:13980703-13980725 CCCCGCCGTGAATAGTGCAGCCA No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data
1176856792_1176856800 10 Left 1176856792 21:13980708-13980730 CCGTGAATAGTGCAGCCACGGAT No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data
1176856790_1176856800 13 Left 1176856790 21:13980705-13980727 CCGCCGTGAATAGTGCAGCCACG No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data
1176856794_1176856800 -5 Left 1176856794 21:13980723-13980745 CCACGGATCCTTAAGGCCCCCAA No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data
1176856787_1176856800 21 Left 1176856787 21:13980697-13980719 CCTGATCCCCGCCGTGAATAGTG No data
Right 1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176856800 Original CRISPR CCCAACCCGCTCCCCACGAT GGG Intergenic
No off target data available for this crispr