ID: 1176857371

View in Genome Browser
Species Human (GRCh38)
Location 21:13983898-13983920
Sequence CATAACATGGTCCCCACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176857371_1176857384 23 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857384 21:13983944-13983966 CCATAGAGGAGGACAGGTTAGGG No data
1176857371_1176857380 17 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857380 21:13983938-13983960 CAATTCCCATAGAGGAGGACAGG No data
1176857371_1176857382 22 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857382 21:13983943-13983965 CCCATAGAGGAGGACAGGTTAGG No data
1176857371_1176857379 12 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857379 21:13983933-13983955 GACTGCAATTCCCATAGAGGAGG No data
1176857371_1176857378 9 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857378 21:13983930-13983952 TGGGACTGCAATTCCCATAGAGG No data
1176857371_1176857377 -10 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857377 21:13983911-13983933 CCATGTTATGGGTGCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176857371 Original CRISPR CATAACATGGTCCCCACCAT GGG (reversed) Intergenic
No off target data available for this crispr