ID: 1176857377

View in Genome Browser
Species Human (GRCh38)
Location 21:13983911-13983933
Sequence CCATGTTATGGGTGCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176857371_1176857377 -10 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857377 21:13983911-13983933 CCATGTTATGGGTGCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176857377 Original CRISPR CCATGTTATGGGTGCTCTCT GGG Intergenic
No off target data available for this crispr