ID: 1176857382

View in Genome Browser
Species Human (GRCh38)
Location 21:13983943-13983965
Sequence CCCATAGAGGAGGACAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176857372_1176857382 21 Left 1176857372 21:13983899-13983921 CCATGGTGGGGACCATGTTATGG No data
Right 1176857382 21:13983943-13983965 CCCATAGAGGAGGACAGGTTAGG No data
1176857371_1176857382 22 Left 1176857371 21:13983898-13983920 CCCATGGTGGGGACCATGTTATG No data
Right 1176857382 21:13983943-13983965 CCCATAGAGGAGGACAGGTTAGG No data
1176857376_1176857382 9 Left 1176857376 21:13983911-13983933 CCATGTTATGGGTGCTCTCTGGG No data
Right 1176857382 21:13983943-13983965 CCCATAGAGGAGGACAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176857382 Original CRISPR CCCATAGAGGAGGACAGGTT AGG Intergenic
No off target data available for this crispr