ID: 1176857538

View in Genome Browser
Species Human (GRCh38)
Location 21:13984680-13984702
Sequence CCTGGCACGGAGCAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176857538_1176857550 28 Left 1176857538 21:13984680-13984702 CCTCCCAGCTGCTCCGTGCCAGG No data
Right 1176857550 21:13984731-13984753 CACCACAGCTCGCTTCTCTGTGG No data
1176857538_1176857547 -4 Left 1176857538 21:13984680-13984702 CCTCCCAGCTGCTCCGTGCCAGG No data
Right 1176857547 21:13984699-13984721 CAGGAGGAGGAGGAGACACCTGG No data
1176857538_1176857551 29 Left 1176857538 21:13984680-13984702 CCTCCCAGCTGCTCCGTGCCAGG No data
Right 1176857551 21:13984732-13984754 ACCACAGCTCGCTTCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176857538 Original CRISPR CCTGGCACGGAGCAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr