ID: 1176864008

View in Genome Browser
Species Human (GRCh38)
Location 21:14032466-14032488
Sequence TGTAACCCCCAAGAATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 2, 1: 2, 2: 2, 3: 22, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176864005_1176864008 15 Left 1176864005 21:14032428-14032450 CCATGAGAAGATCTTTCCTCTGG No data
Right 1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG 0: 2
1: 2
2: 2
3: 22
4: 196
1176864007_1176864008 -1 Left 1176864007 21:14032444-14032466 CCTCTGGTTTTACTCTGCTTGCT 0: 3
1: 2
2: 2
3: 30
4: 366
Right 1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG 0: 2
1: 2
2: 2
3: 22
4: 196
1176864004_1176864008 18 Left 1176864004 21:14032425-14032447 CCTCCATGAGAAGATCTTTCCTC No data
Right 1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG 0: 2
1: 2
2: 2
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176864008 Original CRISPR TGTAACCCCCAAGAATGCAG AGG Intergenic
900714491 1:4135399-4135421 TGCAATCCCCAAGGATGCACTGG + Intergenic
900822428 1:4899767-4899789 TGTAAGCTCCAAGAGGGCAGAGG + Intergenic
901680240 1:10908915-10908937 AGTAACCCCCGAGAAAGCATGGG + Intergenic
902407145 1:16190855-16190877 TGTATACCCAAAGAAAGCAGTGG + Intergenic
903106432 1:21084499-21084521 TGTAATCCCCAACAAGTCAGGGG - Intronic
903765030 1:25728629-25728651 TGTAACACCCAAGATTGCCTCGG + Intronic
904931043 1:34087754-34087776 TGTAACCTCCATGAAGGCGGTGG + Intronic
905311815 1:37054314-37054336 TGCTGCCCTCAAGAATGCAGAGG - Intergenic
908897921 1:68922049-68922071 TGTATGCTCCAAGAAGGCAGGGG - Intergenic
908996486 1:70162250-70162272 TATAACCCCTAAGGATGGAGTGG + Intronic
909002813 1:70239714-70239736 TAAAACCCCCAAAAATTCAGAGG + Intronic
912309842 1:108609288-108609310 TGTAAGCTCCACAAATGCAGGGG - Intronic
912563407 1:110566418-110566440 TGTTAGCCCCCAGAATGCAAGGG + Intergenic
913499029 1:119453646-119453668 TGTAATCCCCAAGAAAGAATGGG + Intergenic
913510265 1:119554855-119554877 TGTAATCCCCAAGAAAGAAAGGG + Intergenic
913514085 1:119587969-119587991 TGTAATCCCCAAGAAAGAAAGGG + Intergenic
915590382 1:156867117-156867139 TGAAACCCCCATCAAAGCAGGGG + Intronic
915612765 1:157007877-157007899 TGTAAGCTCCAAGAAGGCAAAGG + Intronic
917695391 1:177517673-177517695 TGTAAACCCCATGAAGGTAGGGG - Intergenic
918021136 1:180692281-180692303 GGTTAACCCCAAGAATGAAGTGG + Intronic
919929216 1:202210254-202210276 TGGGACCCCCAAGAAAGCAGGGG + Intronic
923405611 1:233656091-233656113 TGTAACCCATTTGAATGCAGAGG - Intronic
923447727 1:234088059-234088081 TGTAAGCTCCATGAATGCAGGGG + Intronic
923632447 1:235660345-235660367 TGTAACCTCCAGGAGTGCAGGGG + Intergenic
923789283 1:237097795-237097817 TGTCACCCCCAGGGATGGAGTGG + Intronic
1062830900 10:605045-605067 TGTAAACTCCAAGGTTGCAGTGG - Intronic
1066637097 10:37514577-37514599 TGTACTCCCCAAAAATGCATAGG + Intergenic
1070311989 10:75280686-75280708 TGTAAGCACCATGAAGGCAGAGG - Intergenic
1073144678 10:101272714-101272736 TCCAACCCCCAAGTCTGCAGGGG + Intergenic
1073514359 10:104063805-104063827 TGGAACTCCGAAGACTGCAGGGG + Exonic
1073830824 10:107380886-107380908 AGTCACCCTCAACAATGCAGAGG - Intergenic
1074125866 10:110528470-110528492 GCTAACCCCCCAGCATGCAGTGG + Intergenic
1075715124 10:124551337-124551359 TGTCACCACCAAGGATGCAGAGG - Intronic
1076244601 10:128936761-128936783 TGCAAACTCCAAGAATGCAAAGG + Intergenic
1076816744 10:132918810-132918832 GGCACCCCCCAAGAAGGCAGGGG - Intronic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1077141618 11:1027314-1027336 TGTAACCCTCCAGTATGCACGGG + Exonic
1077148069 11:1054692-1054714 TGCGACCCCCAAGCCTGCAGAGG - Intergenic
1078425808 11:11250384-11250406 TGCAAGCCCCAAGAAAACAGGGG + Intergenic
1079303811 11:19304617-19304639 TATAACCCCCAATATTGGAGTGG - Intergenic
1080141431 11:28925635-28925657 TGTCACAGCCTAGAATGCAGTGG - Intergenic
1080595056 11:33765650-33765672 TGTAATCCCCAATATTGGAGGGG + Intronic
1081779941 11:45703237-45703259 TGTAAGCTCCAGGAAAGCAGGGG + Intergenic
1081819760 11:45981036-45981058 TGTAAGCCCCATGAGTGCAGGGG + Intronic
1082107985 11:48241813-48241835 TGAAACCCCCTACAATGCACAGG - Intergenic
1082130745 11:48486275-48486297 TCTAACCCTCAGAAATGCAGAGG - Intergenic
1082246040 11:49923815-49923837 TCTAACCCTCAGAAATGCAGAGG + Intergenic
1082564254 11:54657148-54657170 TCTAACCCTCAGAAATGCAGAGG - Intergenic
1082916045 11:58438597-58438619 TGTAATCCCCAGGAATGTATGGG - Intergenic
1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG + Intronic
1084947419 11:72646029-72646051 TTTTGTCCCCAAGAATGCAGTGG + Intronic
1085195990 11:74672097-74672119 TGTAAGCTCCATGAAGGCAGGGG - Intergenic
1087515080 11:99149204-99149226 TGTAACCCCACACACTGCAGTGG - Intronic
1091080876 11:132666468-132666490 TGTGAGCCCCAAGATTGGAGTGG - Intronic
1091391611 12:129529-129551 TGTATCCCCCAGGACTGCTGGGG - Intronic
1094406644 12:30123277-30123299 TGTAAACTCCATGAATTCAGAGG - Intergenic
1096757452 12:53811889-53811911 TGTAACCTCCCAGAAGGCTGAGG - Intergenic
1097220486 12:57447517-57447539 TGGCACCACCAAGAATGAAGAGG + Intronic
1097337859 12:58404682-58404704 TTTAACCCCCTATTATGCAGTGG + Intergenic
1100309818 12:93383886-93383908 AGTGACCCCTAAGAATGAAGAGG - Intronic
1100853838 12:98740698-98740720 TGCAGCCCCCAACAATGCAGGGG - Intronic
1101250713 12:102931948-102931970 TGTAAGCCCCAGGATGGCAGGGG - Intronic
1101874324 12:108588793-108588815 TGTGACCCCCAAGACTGGTGGGG - Intergenic
1103147886 12:118611131-118611153 TGTAATCCCCAAGAGGGAAGAGG + Intergenic
1103859232 12:123998717-123998739 TGTAAACCACAGAAATGCAGAGG + Intronic
1104253415 12:127118037-127118059 TGTAATCCCAAACAAGGCAGTGG - Intergenic
1105429097 13:20320948-20320970 TGTAAGCCCCAAGAATGAAAGGG + Intergenic
1106157113 13:27169787-27169809 TGTAAACACCAAGAAAACAGGGG + Intronic
1106733931 13:32570328-32570350 TGTAATCCCCAATGCTGCAGTGG - Intergenic
1107037091 13:35912871-35912893 TGCAACCCCCAAGACCCCAGAGG - Intronic
1108275115 13:48800547-48800569 TGTAAGTCCCTTGAATGCAGAGG - Intergenic
1109238350 13:59851531-59851553 TGTAAACTTCAAGAAAGCAGAGG + Intronic
1109744591 13:66606875-66606897 GGTAACCCACAATAATACAGTGG - Intronic
1121333341 14:93061627-93061649 TGTAATTCCCCAAAATGCAGGGG + Intronic
1122140528 14:99660377-99660399 TGAAATCCCCAAAAATGTAGAGG - Exonic
1125344764 15:38707997-38708019 TGTAACACCCAAGAATGACCAGG + Intergenic
1126545920 15:49874145-49874167 TGTAACCTTCACGAAGGCAGTGG - Intronic
1127551828 15:60045969-60045991 TGTAAACCGCATGAAGGCAGAGG + Intronic
1127655070 15:61047962-61047984 TAAAACTCCCCAGAATGCAGAGG + Intronic
1128963202 15:72030405-72030427 TGTATCCCCCATGAATAAAGTGG - Intronic
1129082663 15:73053460-73053482 TGTAATCCCCAGGAAAGAAGAGG - Intronic
1130008679 15:80129172-80129194 TGTAAGCTCCAAGAGGGCAGGGG - Intronic
1134860779 16:17558501-17558523 TGTAACCCCCACGAGTCAAGAGG - Intergenic
1135689858 16:24527604-24527626 TTTAACCCCCCAGGAGGCAGAGG - Intergenic
1138878154 16:60978399-60978421 TGTACCTCGCAAGAATGCAATGG + Intergenic
1141099144 16:81184382-81184404 TATCACCCCCAGGAATGCAGAGG - Intergenic
1141229618 16:82153151-82153173 TGTAACCTCCAGGAGAGCAGAGG - Intronic
1143281560 17:5758374-5758396 TGTAAACCCCACGAGGGCAGGGG + Intergenic
1147968579 17:44207358-44207380 TCTCACCCCCCAGAATGAAGAGG - Exonic
1149600814 17:57891934-57891956 TGTAAGCTCCATGAAGGCAGGGG + Intronic
1150954539 17:69842796-69842818 TTTAACACCCAAGAAGGAAGAGG + Intergenic
1151183191 17:72344418-72344440 TGGAAGCCCCAGGAAGGCAGGGG + Intergenic
1152897598 17:82922033-82922055 TGTAACCCCCAGGACGGGAGGGG - Intronic
1203175605 17_KI270729v1_random:10725-10747 TGGAATCCCCAGGAATTCAGTGG - Intergenic
1153608957 18:6862353-6862375 TGTCACCCCCAAGACTTCAGGGG + Intronic
1153934387 18:9907994-9908016 TGTAAACCCCATGAGAGCAGGGG - Intergenic
1154409212 18:14127423-14127445 TGTAACCCCCAAGAATGCAGAGG - Intronic
1155520306 18:26661219-26661241 TGAAACCCCCTATAATGCTGCGG + Intergenic
1155745162 18:29347322-29347344 TATCTCCCCCAAGAGTGCAGTGG - Intergenic
1155911202 18:31506048-31506070 TGTAAGCTCCAGGATTGCAGGGG - Intronic
1157268825 18:46253283-46253305 CGTAACCACCTAGAAGGCAGTGG - Intronic
1160072170 18:75638641-75638663 TGGAAACCCCAGGAATGCTGGGG - Intergenic
1160345936 18:78131771-78131793 TTGAACCCTCAAGAAAGCAGAGG + Intergenic
1161397076 19:4050416-4050438 TGTGAGCCCCGAGAAGGCAGGGG + Intronic
1164687104 19:30174106-30174128 TGTAACCCCCAGGCATGGAGCGG + Intergenic
1166243791 19:41511481-41511503 TGTTACTCCCAATATTGCAGGGG - Intergenic
927958453 2:27224523-27224545 TGTGACCCTCAAGAATGGAAAGG + Intronic
928302311 2:30136781-30136803 TGTATCCCCCATGAATGGGGGGG - Intergenic
932799070 2:74723421-74723443 TGTATCCCCCAAAAATTCATAGG - Intergenic
933246347 2:79979127-79979149 TGTAATCCCCGAGACTCCAGAGG + Intronic
937189988 2:120085950-120085972 TGTAATCCCCACCAAGGCAGGGG + Intronic
937820960 2:126309941-126309963 TGTAACTTCCAAAAAAGCAGAGG - Intergenic
938241113 2:129742850-129742872 TGCAGCCCCCACGAGTGCAGAGG + Intergenic
939403047 2:141719624-141719646 TGTATCCACCAACAATGCATTGG + Intronic
941709658 2:168698600-168698622 TGTAATCCCCAAATATGAAGGGG - Intronic
942990885 2:182201303-182201325 TGAAACCCCCAAGAATGTGTAGG + Intronic
945617376 2:212089442-212089464 TGTAACCCCCAATGTTGGAGGGG + Intronic
946232630 2:218301924-218301946 TGTAAACTCCAAGAAAGCGGGGG - Intronic
948385640 2:237578848-237578870 TGTCTCCCCCAGGAAGGCAGGGG + Intronic
948572742 2:238927693-238927715 TGTAACCCCAAGGAGAGCAGAGG + Intergenic
1169836478 20:9885422-9885444 GGAAAACTCCAAGAATGCAGAGG + Intergenic
1170393567 20:15902318-15902340 TATAAGCCCCAAGAAAGCAGGGG - Intronic
1171184587 20:23116263-23116285 TGGAGCCCCCAGGAATGCATGGG + Intergenic
1172093948 20:32451667-32451689 TGTAGGCTCCATGAATGCAGGGG + Intronic
1172836763 20:37878118-37878140 GGAAACCCCCAGGAGTGCAGGGG + Intergenic
1172853104 20:37980967-37980989 TGCATCCTCCAAGACTGCAGTGG - Intergenic
1173024776 20:39297844-39297866 GGTAAACTCCAAGAAGGCAGGGG + Intergenic
1173505576 20:43584536-43584558 TGTAAGCTCCATGAATGCAGGGG + Intronic
1174634528 20:51987592-51987614 TGTAAGCCCCAAGAGGACAGGGG - Intergenic
1175164049 20:57030464-57030486 TGTATCCCCCAAGAATAATGAGG - Intergenic
1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG + Intergenic
1180153204 21:45963057-45963079 TGTAATCCCCAGGAAAGCTGTGG - Intergenic
1183016474 22:34992325-34992347 TGTAACTCTCCAGAATGAAGAGG - Intergenic
950422111 3:12905354-12905376 TGTGACCCTCAACAATGCTGTGG + Intronic
951477182 3:23119319-23119341 TGTAACCCCGATGAATTTAGAGG + Intergenic
953624040 3:44555969-44555991 TGTATCCTCCCAGAAAGCAGGGG + Intronic
954714611 3:52520855-52520877 CGTAATCCCAAAGAGTGCAGCGG - Exonic
954770868 3:52967060-52967082 AGTAACCCACAGGAAAGCAGAGG + Intronic
957717906 3:83955550-83955572 TGTACCAGCCAAGAATGCAAAGG + Intergenic
959079086 3:101780782-101780804 TGTAACCTCCATGAATACATGGG + Intronic
960901672 3:122560424-122560446 TCTGTCCCCCAGGAATGCAGTGG + Intronic
962068387 3:132007990-132008012 TGTAACCTCCTGGAAAGCAGGGG + Intronic
963249747 3:143092207-143092229 TGTAACCCCACTGTATGCAGGGG + Intergenic
963811175 3:149777841-149777863 TGTAAACACCCAGAGTGCAGAGG + Intronic
965377119 3:167939062-167939084 TGTCACCTCCATGAAGGCAGGGG - Intergenic
965603149 3:170474297-170474319 TGTGATCCCAAAGAATGAAGAGG - Intronic
968385006 4:128095-128117 TCTAACCCCTAAGAATGTAGAGG + Intronic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968401183 4:299128-299150 TGTAACCCCTAAGAATGCTGAGG - Intronic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
970072272 4:12174510-12174532 TGAAACCCCCAAGAACAGAGTGG + Intergenic
971571410 4:28215884-28215906 TGAAACCACAAAGAATGCAGAGG - Intergenic
973689517 4:53410951-53410973 TGTATCCCCCAAGAATAAGGTGG + Intronic
981460901 4:145012856-145012878 TGTAATCCCCAATGATGGAGGGG + Intronic
981472856 4:145156935-145156957 TGTGACACCCAAGTATACAGAGG + Intronic
983127889 4:163976943-163976965 TTTAACGCCCATGAATTCAGTGG - Intronic
984134930 4:175924379-175924401 TGTAACCCCCAAAGGTGCTGTGG + Intronic
984807567 4:183765669-183765691 TGTATGCCCCAAGAATGAAAGGG + Intergenic
989997224 5:50850028-50850050 TGGAACTGCCAAGAATTCAGTGG - Intergenic
990172188 5:53064799-53064821 TGTAATCCCAAAGACTCCAGAGG - Intronic
990399427 5:55423250-55423272 TGTAAACTCCATGAAGGCAGGGG - Intronic
990694448 5:58400234-58400256 TGTAAGCTCCAAGAAGGCAGGGG + Intergenic
990728669 5:58784923-58784945 TGTATCCCACAGGAAAGCAGTGG + Intronic
992765681 5:79997055-79997077 AGTAACCCACAAGAAAGCAAGGG + Intronic
994396350 5:99228549-99228571 TGTTACTCCCAATATTGCAGTGG - Intergenic
995418605 5:111937255-111937277 TGTAACACCCTAGAGTCCAGGGG + Intronic
997513536 5:134468841-134468863 TGTAACTCGCAAGCATGCAGAGG - Intergenic
998785031 5:145699832-145699854 TGGAATCCCCAAGAATACAAAGG - Intronic
1000288530 5:159848163-159848185 TATAACCTCCAGGAAGGCAGGGG - Intergenic
1000818036 5:165948083-165948105 TGTGAAACCCAAGTATGCAGAGG - Intergenic
1002579506 5:180199107-180199129 TGCAGCCCCCAGGAGTGCAGAGG + Intronic
1005162829 6:22884163-22884185 TGTAACCCCCATGAGAACAGAGG + Intergenic
1008672645 6:53787954-53787976 TGTAACTCCTATGAATGGAGGGG + Intergenic
1009366070 6:62858933-62858955 TATTACCCCCAATATTGCAGAGG + Intergenic
1011618652 6:89221390-89221412 TGTAAAACCCACGGATGCAGAGG - Intronic
1012174697 6:96066086-96066108 TGTAACTCTAAACAATGCAGTGG - Intronic
1012956948 6:105581486-105581508 TTTAATACTCAAGAATGCAGTGG + Intergenic
1014005047 6:116408372-116408394 TGGAACCCCGAAAAATGCTGGGG - Intronic
1017472014 6:154747865-154747887 TGTAAACTCCATGAAGGCAGAGG - Intronic
1019133952 6:169896810-169896832 TGTAACCATCAAGAAGGCAGAGG + Intergenic
1019169216 6:170121745-170121767 GATAACCCCCAAGAAGTCAGGGG - Intergenic
1019980706 7:4619933-4619955 TGGAAGCCCAGAGAATGCAGAGG + Intergenic
1021253997 7:18367206-18367228 TGCAACCCCTTAGAATGCACTGG - Intronic
1022392705 7:29957526-29957548 TGTAAGCCCCAAGAGGGAAGGGG + Intronic
1022657317 7:32331354-32331376 TGTAAACTCCATGAAGGCAGGGG - Intergenic
1022742068 7:33131655-33131677 AATAACCCCAAAGAATGCTGTGG - Intronic
1025791265 7:64689195-64689217 TGTAACACCCAAAAATGCAGAGG + Intronic
1026815002 7:73504016-73504038 TCTAAACCCCAAGGAAGCAGAGG - Intronic
1029620470 7:101687513-101687535 TGGAACCCCCAATACTGCAGGGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1029925285 7:104309341-104309363 TATAACCCCCTAAAATGCATGGG - Intergenic
1035298909 7:157884435-157884457 TGGAAACCCCATCAATGCAGAGG + Intronic
1038423633 8:27450976-27450998 TGAAAGCACCAAGAATGCAGGGG - Intronic
1038503294 8:28063204-28063226 GAAAACCCACAAGAATGCAGGGG + Intronic
1038638040 8:29303068-29303090 TGTTACTCCCAATATTGCAGGGG - Intergenic
1038969920 8:32621833-32621855 TTTAACCCCAGATAATGCAGTGG + Intronic
1040810674 8:51449080-51449102 AGTAACCCCCAAGGATCAAGTGG - Exonic
1040907275 8:52481291-52481313 TGTAAACCCCTTGAAAGCAGAGG - Intergenic
1042368931 8:67968852-67968874 ACTAACCCACAAGAATGCAAAGG + Intronic
1042515655 8:69656044-69656066 TGAAACACACAAGAATGCAGGGG - Intronic
1043888995 8:85635332-85635354 TGTAAACCCCACAAATGCAAAGG - Intergenic
1044033816 8:87272975-87272997 TGTAACATCCAAGTATGGAGGGG + Intronic
1044858414 8:96498237-96498259 TGCAAGCTCCAAGAAGGCAGGGG - Intronic
1045946288 8:107800431-107800453 TATAAGACCCATGAATGCAGGGG - Intergenic
1047911719 8:129537056-129537078 TGTAAGCTCCATGAAGGCAGTGG - Intergenic
1047954314 8:129961601-129961623 TGTAAGCTCCAAGAGGGCAGGGG + Intronic
1047992602 8:130301947-130301969 TGTAACCTCCACGATGGCAGGGG + Intronic
1051028776 9:12648143-12648165 TGTTCCCACAAAGAATGCAGTGG + Intergenic
1055099363 9:72447231-72447253 TGTAACCCCCAATACTGGAGAGG + Intergenic
1055288996 9:74762780-74762802 GGCATCCCCCAAGAGTGCAGAGG - Exonic
1055555724 9:77471399-77471421 TGGACAGCCCAAGAATGCAGGGG + Intronic
1059570630 9:115430731-115430753 TGTCAGCTCCTAGAATGCAGTGG + Intergenic
1060768357 9:126311848-126311870 TGTAACCCCCAGCATTGGAGTGG - Intergenic
1062216759 9:135393473-135393495 TTCAACCCCCAACAATGCACGGG + Intergenic
1185570650 X:1132226-1132248 TGTCCCCCCCAAAAAGGCAGAGG - Intergenic
1186643033 X:11476892-11476914 TGTATACCACAAGATTGCAGAGG - Intronic
1188166378 X:26869718-26869740 TGTAACCCCCAATGCTGGAGTGG - Intergenic
1188613945 X:32134202-32134224 TGAGACCCCCAAGAATCCAGAGG + Intronic
1190377726 X:49806231-49806253 TGTATCCACAAAGAATTCAGGGG + Intergenic
1192814625 X:74577751-74577773 TGTAACCTCCATGATGGCAGGGG + Intergenic
1196104469 X:111881602-111881624 TGACACCCCCAAGAAACCAGGGG - Intronic
1196846374 X:119899652-119899674 TGGAACCCCCTAGAAGCCAGAGG + Intronic
1198524864 X:137490993-137491015 TGTATCCCCCCACAATACAGAGG + Intergenic
1201560392 Y:15310153-15310175 TGTAACCCCCAAGAAGGTGAGGG - Intergenic