ID: 1176867704

View in Genome Browser
Species Human (GRCh38)
Location 21:14063175-14063197
Sequence GGCGATACCCCTCCAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176867698_1176867704 0 Left 1176867698 21:14063152-14063174 CCAGCGGCAAGGGACAGTTTGGG No data
Right 1176867704 21:14063175-14063197 GGCGATACCCCTCCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176867704 Original CRISPR GGCGATACCCCTCCAGTGGT GGG Intergenic
No off target data available for this crispr