ID: 1176867780

View in Genome Browser
Species Human (GRCh38)
Location 21:14063472-14063494
Sequence CCCAACCCGCTCCCCACGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176867780_1176867791 14 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867791 21:14063509-14063531 GTGGCTGCACTATTCACGGCGGG No data
1176867780_1176867786 -5 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867786 21:14063490-14063512 TTGGGGGCCTTAAGGATCCGTGG No data
1176867780_1176867792 15 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867792 21:14063510-14063532 TGGCTGCACTATTCACGGCGGGG No data
1176867780_1176867788 10 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867788 21:14063505-14063527 ATCCGTGGCTGCACTATTCACGG No data
1176867780_1176867793 21 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867793 21:14063516-14063538 CACTATTCACGGCGGGGATCAGG No data
1176867780_1176867790 13 Left 1176867780 21:14063472-14063494 CCCATCGTGGGGAGCGGGTTGGG No data
Right 1176867790 21:14063508-14063530 CGTGGCTGCACTATTCACGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176867780 Original CRISPR CCCAACCCGCTCCCCACGAT GGG (reversed) Intergenic
No off target data available for this crispr