ID: 1176869704

View in Genome Browser
Species Human (GRCh38)
Location 21:14075040-14075062
Sequence CTGTTGTAGCAGAGGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176869689_1176869704 29 Left 1176869689 21:14074988-14075010 CCTCTCCCCATCCAAGGACCTCT No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data
1176869690_1176869704 24 Left 1176869690 21:14074993-14075015 CCCCATCCAAGGACCTCTTCAGG No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data
1176869696_1176869704 11 Left 1176869696 21:14075006-14075028 CCTCTTCAGGAAGCACTGGCAAA No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data
1176869692_1176869704 23 Left 1176869692 21:14074994-14075016 CCCATCCAAGGACCTCTTCAGGA No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data
1176869693_1176869704 22 Left 1176869693 21:14074995-14075017 CCATCCAAGGACCTCTTCAGGAA No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data
1176869694_1176869704 18 Left 1176869694 21:14074999-14075021 CCAAGGACCTCTTCAGGAAGCAC No data
Right 1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176869704 Original CRISPR CTGTTGTAGCAGAGGGCATG GGG Intergenic
No off target data available for this crispr