ID: 1176870521

View in Genome Browser
Species Human (GRCh38)
Location 21:14080129-14080151
Sequence GGTTATCTGCAGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176870521_1176870525 -2 Left 1176870521 21:14080129-14080151 CCTGCCATTATCTGCAGATAACC No data
Right 1176870525 21:14080150-14080172 CCATTCTTCTTTGGAGCCACAGG No data
1176870521_1176870527 18 Left 1176870521 21:14080129-14080151 CCTGCCATTATCTGCAGATAACC No data
Right 1176870527 21:14080170-14080192 AGGCTATCTCAGCTAGCCTCTGG No data
1176870521_1176870528 25 Left 1176870521 21:14080129-14080151 CCTGCCATTATCTGCAGATAACC No data
Right 1176870528 21:14080177-14080199 CTCAGCTAGCCTCTGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176870521 Original CRISPR GGTTATCTGCAGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr