ID: 1176870701

View in Genome Browser
Species Human (GRCh38)
Location 21:14081249-14081271
Sequence CGAGCATGCCGCTGTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176870700_1176870701 5 Left 1176870700 21:14081221-14081243 CCTGGGAGGTGGAGGTTGCAGTG 0: 31005
1: 97113
2: 188789
3: 192956
4: 135326
Right 1176870701 21:14081249-14081271 CGAGCATGCCGCTGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176870701 Original CRISPR CGAGCATGCCGCTGTGCTCC AGG Intergenic
No off target data available for this crispr