ID: 1176874483

View in Genome Browser
Species Human (GRCh38)
Location 21:14114705-14114727
Sequence CCCTCAGAGAAACTAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176874479_1176874483 -5 Left 1176874479 21:14114687-14114709 CCTGAGTCATGCAGATTCCCCTC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1176874476_1176874483 30 Left 1176874476 21:14114652-14114674 CCAGGATAAGGTTGGCGGTCTTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176874483 Original CRISPR CCCTCAGAGAAACTAGATTT GGG Intronic
902917404 1:19646886-19646908 GCCCCAGTGAAACTGGATTTAGG - Intronic
904549662 1:31305143-31305165 CCCCCAAAGAAACTAGAGCTGGG - Intronic
904553050 1:31337219-31337241 CCCTCTGAGATAGTAGATGTTGG + Exonic
904846708 1:33424593-33424615 CCCTTTGAGAAACAAGTTTTGGG - Intronic
906809502 1:48811703-48811725 ACCTCACAGAAACCAGAGTTGGG - Intronic
907397680 1:54203006-54203028 CCCTTAGAGAAGCCAAATTTGGG + Intronic
907631559 1:56088463-56088485 CCCTGAGATAACCTAGATGTTGG - Intergenic
907740318 1:57159337-57159359 TCCTCAGAGAAACTAGAAAATGG - Intronic
908356321 1:63327645-63327667 CCCTCCGAGGAACTAGATACGGG - Intergenic
908713565 1:67045254-67045276 CACTGACTGAAACTAGATTTAGG + Intronic
910287937 1:85575779-85575801 CCAGCAGCGAAACTGGATTTGGG - Intronic
910560826 1:88588928-88588950 ACATCAGACAAAATAGATTTTGG + Intergenic
910978647 1:92936291-92936313 CCTTCAGAAAAACTATACTTAGG - Intronic
911078366 1:93902676-93902698 CCCTAAGATAAACTGGACTTGGG - Intronic
911611922 1:99967576-99967598 CCCTCAGAGAGAATAGATGGTGG + Intergenic
911764178 1:101654515-101654537 CACATAGAGAAACTAGTTTTTGG + Intergenic
912019297 1:105086609-105086631 CTCTCTTAGAAATTAGATTTAGG - Intergenic
916925888 1:169520464-169520486 CACTCAAAGAATCAAGATTTGGG - Intronic
918139140 1:181705623-181705645 CCCTCAGAGGAGCCAGGTTTGGG + Intronic
918491963 1:185090432-185090454 CACTTAGACAAACTTGATTTAGG - Intronic
919325323 1:196099882-196099904 GCCTCAGAGAAACTGGCTTCAGG + Intergenic
921199726 1:212793021-212793043 CCCCCAGACAAGCTAGAATTTGG + Intronic
922914254 1:229242744-229242766 TCCACAGAGAAAATAGAATTAGG + Intergenic
924732647 1:246725800-246725822 CCCACAATGAAACTTGATTTGGG - Intronic
1063807762 10:9666771-9666793 CCCTCAGAGAAGCCAGGTTCTGG + Intergenic
1066400637 10:35072702-35072724 GCCTCAGACAAACTGCATTTAGG + Intronic
1067171368 10:43909456-43909478 ACTCCAGAGATACTAGATTTTGG - Intergenic
1068482871 10:57616720-57616742 ACCTGAAAGAAACAAGATTTAGG - Intergenic
1070109305 10:73467441-73467463 ACCACAGTGAAACTAGACTTTGG + Intronic
1071801809 10:89071753-89071775 CCTTCAGAGAACTTATATTTGGG - Intergenic
1071888616 10:89978146-89978168 CCCTCAGTGTGACTATATTTTGG + Intergenic
1072366889 10:94720604-94720626 CTCTAAGAGAAACAAGATTGAGG - Intronic
1074738199 10:116457945-116457967 TCCTCTGAGAAATTAGTTTTTGG + Intronic
1074738719 10:116463746-116463768 ATCTTTGAGAAACTAGATTTTGG - Intronic
1075865165 10:125712415-125712437 ACCCCAGAGATACTAGATTCTGG + Intergenic
1077938929 11:6818914-6818936 CCTTCAGGGAACCTGGATTTAGG + Intergenic
1078416837 11:11172986-11173008 CCCTCAGAGAACCTGGGTTTGGG - Intergenic
1078440720 11:11364838-11364860 CCCTCAAAATAACTAGAGTTAGG + Intronic
1078524871 11:12092615-12092637 CCCTCAGAGACACCAGTGTTGGG + Intergenic
1079031452 11:16989175-16989197 CCCTCTGAGAAATTAGCTCTGGG - Intronic
1080381240 11:31774294-31774316 ACCTCAGAGAAAAAAGATTAAGG - Intronic
1080448554 11:32359527-32359549 CTCTGAGTGAGACTAGATTTAGG - Intergenic
1083136979 11:60688338-60688360 CCCTGAGAGCACCTTGATTTTGG + Intergenic
1086507663 11:87522820-87522842 CCCTAAGAGTAAGTAGATTACGG + Intergenic
1090036222 11:123251929-123251951 CCCTGCTAGAAACTTGATTTTGG + Intergenic
1090214228 11:124946818-124946840 CTCTCAGGGGAACTGGATTTTGG - Intergenic
1091120348 11:133052427-133052449 CCCTCATAGAGCTTAGATTTGGG + Intronic
1091291003 11:134439848-134439870 CCCTCATAGAGCTTAGATTTTGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094270471 12:28608847-28608869 TTCTCAGAGCTACTAGATTTAGG + Intergenic
1097591565 12:61581711-61581733 CCCAGGGAGAAACAAGATTTTGG + Intergenic
1097634346 12:62104146-62104168 CCCTCAAACAAGCTATATTTAGG - Intronic
1098169995 12:67737393-67737415 ACCTCAGAGTAACTAGAATCCGG - Intergenic
1098638718 12:72815161-72815183 CCCTCTGAAAAACTAAATTCTGG + Intergenic
1099468303 12:83014681-83014703 GCCTCTGAGTAAATAGATTTAGG + Intronic
1099803380 12:87484972-87484994 CCTTCAGAAGATCTAGATTTTGG + Intergenic
1101871941 12:108572808-108572830 CCCTGAGAGAGACAGGATTTAGG - Intergenic
1102661767 12:114535138-114535160 CCATCATAGAAATGAGATTTGGG + Intergenic
1102665979 12:114573201-114573223 CCGTCATAGAAATGAGATTTGGG - Intergenic
1103045726 12:117733077-117733099 GGCTCAGAGCAACTAGATTGAGG + Intronic
1104037909 12:125110933-125110955 CCTTCAGTGAATCTAGATCTAGG - Intronic
1105646497 13:22323822-22323844 CCCTCCGAGATTCTATATTTAGG - Intergenic
1109438162 13:62333869-62333891 TCCTCAGAGTAACTATTTTTGGG + Intergenic
1110618498 13:77568713-77568735 CCTTCAGAGAAAATTGAATTGGG + Intronic
1111229052 13:85316880-85316902 CAATGAGAGAAATTAGATTTAGG + Intergenic
1111603946 13:90512749-90512771 ATCTCAGAGGAAATAGATTTTGG - Intergenic
1112521564 13:100100208-100100230 CCCTCAGAGTCACAAGACTTGGG - Intronic
1113391989 13:109906843-109906865 TCCTTAAAAAAACTAGATTTGGG - Intergenic
1114359040 14:21949771-21949793 CACTCAGAGAAACAAGCTATTGG + Intergenic
1115652690 14:35414448-35414470 GCCTCAGTGAAAAGAGATTTAGG - Intergenic
1117552435 14:56849735-56849757 GCCAGAGAGAACCTAGATTTTGG + Intergenic
1117649499 14:57888162-57888184 ACCTCAGAGAAAGGAGATTTGGG + Intronic
1120219799 14:81719377-81719399 CCCTCTGATAACCTTGATTTGGG - Intergenic
1121240764 14:92428406-92428428 CCCTCAGGGACCCTAGATATGGG - Intronic
1124475818 15:30033547-30033569 CCCTCAGAGAAACATAATTGAGG - Intergenic
1125694923 15:41628036-41628058 CCCTCATGGAAATTATATTTTGG + Intronic
1127760325 15:62133138-62133160 ACCTCAGAAAAACTAGTCTTGGG + Intergenic
1127827582 15:62718541-62718563 GCCTCAGAGAATCCAGATTCAGG - Intronic
1132926565 16:2432760-2432782 ACCTCAGAGAAACTCGTTTCTGG + Intronic
1133629032 16:7601464-7601486 CCCTGAGAGATACTAGTTTAAGG + Intronic
1134291258 16:12903953-12903975 CCCCCAGAGAGAAGAGATTTTGG + Intronic
1135088871 16:19496495-19496517 CCTTCAGAGAATCTACCTTTAGG - Intronic
1137919229 16:52470057-52470079 CCTTCAGAGAAACCAGATAAAGG - Intronic
1138730606 16:59189894-59189916 TCCACAGATAAACTGGATTTTGG - Intergenic
1139393216 16:66619256-66619278 TCCTCAGAGAAAGTTTATTTTGG - Intronic
1139874202 16:70132228-70132250 CCCTCAGTGAAAATTGGTTTCGG - Exonic
1140361575 16:74348916-74348938 CCCTCAGTGAAAATTGGTTTTGG + Intergenic
1140489149 16:75319543-75319565 GCCACTGAGAAAGTAGATTTGGG - Intronic
1141230177 16:82159840-82159862 CCCTGAGGGAATCTAAATTTGGG + Intronic
1144263003 17:13541542-13541564 ATCTCAGAGAAACTGGACTTAGG - Intronic
1148199939 17:45743489-45743511 ACCTCAGAGAAAATAAATGTCGG - Intergenic
1148762577 17:50014594-50014616 CCCTCAGAGAAACTCCACTAGGG - Intergenic
1157451249 18:47790798-47790820 CCGTCAGAGAAACCAGGTGTTGG + Intergenic
1159650101 18:70968261-70968283 AACTCAGAAAAACTAGTTTTAGG - Intergenic
1160625518 18:80201726-80201748 CCCTCACAGAAACTGGATGGGGG + Intronic
1162525105 19:11202277-11202299 CCCTCAGTGAAATATGATTTGGG + Intronic
1164463138 19:28465328-28465350 CCCTCAGAGAAAGCGTATTTTGG + Intergenic
1166282307 19:41802373-41802395 CCCTCAGAGAAGCTAGGCCTCGG + Intronic
926405558 2:12548896-12548918 GCTCCAGGGAAACTAGATTTAGG + Intergenic
927422337 2:22946723-22946745 TCCTCAGAAGAACTAGACTTGGG + Intergenic
928701010 2:33898563-33898585 CCCTAACACAAACTTGATTTTGG + Intergenic
935054660 2:99554853-99554875 CCTTCAGAGAAACTGGACCTGGG + Intronic
937574242 2:123399835-123399857 CCCTCACAGAGACTGGAGTTGGG - Intergenic
937776805 2:125787431-125787453 CCCTCAGAGAAATTTTATTAAGG + Intergenic
940648122 2:156413180-156413202 AGCTCAGAGAAAATATATTTTGG - Intergenic
940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG + Intronic
941034809 2:160556652-160556674 CCCTGACAGTAACTAGATATGGG - Intergenic
942975972 2:182018209-182018231 CCAGCATAGAAACTAGACTTAGG - Intronic
948406371 2:237723126-237723148 TCCTCAGAAAGTCTAGATTTTGG + Intronic
1168896562 20:1327908-1327930 CCCCCAAAGAAAGTACATTTGGG - Intronic
1168916803 20:1495446-1495468 TCCTCAAAAAAACTGGATTTAGG - Intergenic
1168974290 20:1952614-1952636 TCCTCAGAGACACTAGGTTGGGG - Intergenic
1169680123 20:8202883-8202905 CACGCAGAGAAAGTAGAATTTGG + Intronic
1169689210 20:8311566-8311588 CACCCTGAGAAACAAGATTTTGG - Intronic
1170074893 20:12408860-12408882 CCCTCATATAAACTAGTTATTGG - Intergenic
1170099581 20:12684127-12684149 CCCTCACAGAATCTTGATTTTGG + Intergenic
1171073012 20:22093541-22093563 CCTTCAGAGAATCCAGATATTGG - Intergenic
1171943436 20:31353382-31353404 CCCTAAGAGAAACAAGACTGAGG + Intergenic
1172908635 20:38388872-38388894 CCTTCAGACTAACTGGATTTAGG + Intergenic
1172989481 20:39022576-39022598 CCCTGACAGAAACTAGAAGTTGG - Intronic
1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG + Intronic
1174381026 20:50155501-50155523 CCCTCAGAGAACCTGGATTCTGG - Intergenic
1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG + Intronic
1176894052 21:14354520-14354542 CCCTTAGAGAATCTACATTTGGG + Intergenic
1178279362 21:31267668-31267690 CCTTCTGAGAACCTGGATTTTGG + Intronic
949612302 3:5715353-5715375 CCCTCAGAGAGACTCTATTAAGG + Intergenic
951750352 3:26028121-26028143 TCCTCAGAGCTACTAGGTTTTGG + Intergenic
952537451 3:34326380-34326402 CCCTCACAGGAAACAGATTTAGG + Intergenic
952568805 3:34688357-34688379 ACCTCAGAGAAACTAGCCTCTGG + Intergenic
953143140 3:40248059-40248081 TCCTCTGTGAAACTAGACTTTGG - Intronic
953459597 3:43072074-43072096 CCCACAGAGAATGTAGAATTTGG + Intergenic
955224473 3:57049741-57049763 CCAACAGAGAAACTAGCTCTGGG + Intronic
957571396 3:81951216-81951238 CCCTCAGATAATTTAGATGTGGG + Intergenic
959400773 3:105899288-105899310 CCCACAAAGAATCTAAATTTGGG + Intergenic
959552005 3:107671129-107671151 CCTTCAGTGAAAATAGTTTTGGG + Intronic
959863591 3:111242357-111242379 CCCTCAGGGAGCCCAGATTTGGG - Intronic
963965881 3:151369730-151369752 CCCCCAGAGACACTAGATAAGGG - Intronic
964585653 3:158297029-158297051 CCCTCAGAGAAGTGAGATGTGGG + Intronic
965620601 3:170639098-170639120 CCCTCTGCTAAATTAGATTTGGG + Intronic
966396094 3:179504845-179504867 CCCTAAGAGAAACTGGCTCTGGG + Intergenic
967642413 3:191881676-191881698 ACCTCAGAGAACTTAGATTCCGG + Intergenic
969358735 4:6647695-6647717 CCCTCAAAGAGACTAAATTCAGG - Intergenic
969646894 4:8435877-8435899 CCCCCTGAGAAACGAGATTAAGG + Intronic
969982989 4:11178292-11178314 TCCTCAGAGAGAGTAAATTTGGG - Intergenic
971767842 4:30856132-30856154 CTCTCAGATGAACTAAATTTAGG - Intronic
971970606 4:33614787-33614809 CCCTGAGAGAAAATATATTTTGG - Intergenic
973306725 4:48660362-48660384 GCATCTGAGAAATTAGATTTTGG + Intronic
976193751 4:82513770-82513792 CCCTCTGAGACAGTAGAGTTGGG - Intronic
977125416 4:93160458-93160480 CACTCAAAGAAATTGGATTTGGG - Intronic
977942431 4:102873573-102873595 CCATCAGAGAAACAAAATCTAGG - Intronic
978206851 4:106090056-106090078 CCCACAGAGAAACTATACTAGGG - Intronic
979729720 4:124009649-124009671 ACCTCAGAGAAACAAGAAATGGG - Intergenic
979873253 4:125852759-125852781 TCCTCAAAGAAACCAGAATTGGG + Intergenic
982185905 4:152798407-152798429 CACTCAAAGAAACAAGAATTAGG - Intronic
983989306 4:174098299-174098321 TCCTCATAGATACTAGATATTGG - Intergenic
986338014 5:6769281-6769303 CCCTCAGGGAGCCTAGAATTTGG - Intergenic
986839116 5:11675453-11675475 CCCTCAGAGAAACCAGAGTGGGG + Intronic
989763915 5:45055683-45055705 CTTTAAAAGAAACTAGATTTGGG - Intergenic
993135228 5:83952478-83952500 CCCACAGAAAAAGTAGAATTGGG + Intronic
993691159 5:91002502-91002524 CCCTCAGACAACCTTTATTTGGG + Intronic
993976538 5:94489499-94489521 GCATCAAAAAAACTAGATTTGGG + Intronic
996798596 5:127377975-127377997 CCATCAGTGAAACTACCTTTGGG - Intronic
998883097 5:146664735-146664757 CCATCAGAGGAACTATTTTTTGG + Intronic
999380241 5:151116444-151116466 CCCTCAGGGAAAATGAATTTGGG + Intronic
999755852 5:154663810-154663832 CCCACAGAGAAACTCTACTTGGG - Intergenic
1000325302 5:160167639-160167661 TCCTCAGAGATCTTAGATTTTGG + Intergenic
1003527297 6:6909017-6909039 ACCTCAGAGAAACAAGATTGTGG - Intergenic
1003952905 6:11134178-11134200 CCCTCATAGAATTTAGAATTCGG - Intronic
1005952853 6:30644238-30644260 CCCTCAGAGAATCTGGATCTGGG - Intronic
1009370091 6:62888792-62888814 CCCCCAGAGAAAGTGGATATAGG - Intergenic
1009436124 6:63620336-63620358 CCCTCAGAGACTTTAGATGTAGG + Intergenic
1009522676 6:64704562-64704584 CTCTCATTGAAAGTAGATTTGGG + Intronic
1009604645 6:65850893-65850915 AGCTCAGAGTAACTAGATTTAGG - Intergenic
1011472014 6:87717489-87717511 CTCTCAGAGACTCTGGATTTAGG - Intergenic
1012974394 6:105764416-105764438 CCCTCAGAGAAGCAAGGCTTGGG - Intergenic
1013611831 6:111802987-111803009 CCCTTAGAAGAACTAGATTCTGG - Intronic
1014449202 6:121564213-121564235 CCCTCATGGAAACTACATTCTGG + Intergenic
1014985320 6:127999315-127999337 CCCTCAGAGATACCCGATCTAGG + Intronic
1022208671 7:28186893-28186915 CCCAAAGAGAAACTATCTTTAGG + Intergenic
1022647367 7:32243720-32243742 CATGCAGAGAAACTAAATTTTGG - Intronic
1024851556 7:53723496-53723518 CCATGAAATAAACTAGATTTGGG + Intergenic
1028695182 7:93701420-93701442 TCCACAGATGAACTAGATTTTGG + Intronic
1034616913 7:152425906-152425928 CCCTCAGTGAGACTTGTTTTAGG - Intronic
1036795540 8:11753890-11753912 GCCTAAGAGAAACCAGATGTGGG + Intronic
1038163857 8:25065923-25065945 TCATCAGGAAAACTAGATTTGGG + Intergenic
1041740270 8:61150474-61150496 CCCCCATAGAAACTGGATGTGGG - Intronic
1042955781 8:74249222-74249244 CCCTCATAGAAATTTGTTTTGGG - Intronic
1045911148 8:107411874-107411896 ACCACAGAAAAACTAGCTTTAGG - Intronic
1046822629 8:118650734-118650756 CTCTGAAAGAAACTGGATTTTGG + Intergenic
1047923749 8:129661700-129661722 CCCTGAGAGAAACTGGATGAAGG + Intergenic
1050916263 9:11137783-11137805 CCCTAACAGTAACTTGATTTTGG + Intergenic
1055927153 9:81522378-81522400 TCTTCAGATAAACTAGATATGGG + Intergenic
1056544625 9:87603291-87603313 TCCTCAGAGAAATTGGATTTTGG + Intronic
1057994525 9:99808799-99808821 CCATGAGGGAAACTAGCTTTGGG - Intergenic
1059384872 9:113956602-113956624 CCCTCACGGAAACTACAGTTTGG + Intronic
1186213236 X:7272452-7272474 CCTTCAAAGTAACGAGATTTAGG + Intronic
1189367492 X:40400205-40400227 GAGTCAGAAAAACTAGATTTAGG - Intergenic
1193649907 X:84118413-84118435 CCCTCAAAGAAACTACACGTTGG + Intronic
1194307295 X:92263595-92263617 ATCTCAGAGAAACTGGGTTTTGG + Intronic
1194762858 X:97815119-97815141 AACACAGAGAAACTAGATATAGG - Intergenic
1198732729 X:139750508-139750530 TCCTCAGAGAAACTAAATACAGG + Intronic
1199518468 X:148706164-148706186 GGCTCTGAGAAACAAGATTTTGG - Intronic
1202083155 Y:21105616-21105638 CCCTGAGAGAAAGTACAATTTGG - Intergenic