ID: 1176874548

View in Genome Browser
Species Human (GRCh38)
Location 21:14115381-14115403
Sequence CCTTTTAAGCTGTCAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 4, 2: 3, 3: 17, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176874548_1176874552 -3 Left 1176874548 21:14115381-14115403 CCGGCCACTGACAGCTTAAAAGG 0: 1
1: 4
2: 3
3: 17
4: 128
Right 1176874552 21:14115401-14115423 AGGTGGCTGCTTTCTTTGTCCGG 0: 7
1: 1
2: 4
3: 20
4: 187
1176874548_1176874554 -1 Left 1176874548 21:14115381-14115403 CCGGCCACTGACAGCTTAAAAGG 0: 1
1: 4
2: 3
3: 17
4: 128
Right 1176874554 21:14115403-14115425 GTGGCTGCTTTCTTTGTCCGGGG 0: 7
1: 7
2: 3
3: 12
4: 123
1176874548_1176874553 -2 Left 1176874548 21:14115381-14115403 CCGGCCACTGACAGCTTAAAAGG 0: 1
1: 4
2: 3
3: 17
4: 128
Right 1176874553 21:14115402-14115424 GGTGGCTGCTTTCTTTGTCCGGG 0: 11
1: 3
2: 6
3: 34
4: 219
1176874548_1176874555 14 Left 1176874548 21:14115381-14115403 CCGGCCACTGACAGCTTAAAAGG 0: 1
1: 4
2: 3
3: 17
4: 128
Right 1176874555 21:14115418-14115440 GTCCGGGGCTCAGACTTTTCTGG 0: 2
1: 5
2: 7
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176874548 Original CRISPR CCTTTTAAGCTGTCAGTGGC CGG (reversed) Intronic
903866700 1:26404064-26404086 CCTATTGAGTTGGCAGTGGCAGG - Intergenic
908139458 1:61169190-61169212 CCTTTTAAGCTTGCAGCAGCAGG - Intronic
912325652 1:108758330-108758352 CCTTATTAGCTATCACTGGCTGG + Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
920139416 1:203796847-203796869 CCTTTTAAAATGTGAGTGGCTGG - Exonic
922982161 1:229836196-229836218 CCATTTAGGCTGTCAGTGAGCGG + Intergenic
923508515 1:234627987-234628009 CCATTTAAGGTGTCTGTGCCTGG - Intergenic
1063131381 10:3180580-3180602 TCTTTGAAGCTGGCAGTGGCTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1068162283 10:53280274-53280296 CCTTTTCAGCTCTCAGCTGCGGG + Intergenic
1071403710 10:85306181-85306203 ACTTTGAAGCTGACAGGGGCTGG + Intergenic
1073865543 10:107800220-107800242 TCTTTTAAAGTGACAGTGGCAGG + Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1075018894 10:118933101-118933123 CCTATTAAGCTGTCATGGGTGGG - Intergenic
1075714029 10:124545553-124545575 CTTATTGAGCTGTCAGCGGCTGG + Intronic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1083848357 11:65350299-65350321 CTATTTAAGCTGGCTGTGGCTGG - Intronic
1085303311 11:75471359-75471381 CCTCTTAGGCTGTCAGGAGCCGG - Intronic
1085969481 11:81569700-81569722 CCTTTTATGCTGTCCCTGGTAGG + Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1088629727 11:111763164-111763186 TCTTTCAAGCTTTCTGTGGCTGG - Intronic
1091118051 11:133033024-133033046 CATATTTAGCTGTCAGTGGTTGG + Intronic
1091158939 11:133401805-133401827 TCTTTTAAGCTTTCAGTGAGTGG + Intronic
1091504154 12:1050037-1050059 TCTTTTAAAATGTCATTGGCCGG - Intronic
1092164767 12:6336164-6336186 CCTTTAAGGCTGTCTGGGGCTGG - Intronic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1094275296 12:28668592-28668614 CCTTTTAAGCTCTCTGGGGGAGG + Intergenic
1095948285 12:47766368-47766390 CCTTGGAAGCTGCCAGGGGCAGG - Intronic
1100951241 12:99852895-99852917 CCTTTCAGGCTGTGAGTTGCGGG + Intronic
1101914370 12:108884907-108884929 CCTTCTAAGCCTTCAGTGGATGG + Intronic
1106858632 13:33880769-33880791 CATTATAAGATGTTAGTGGCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107840959 13:44457736-44457758 CCTTTTGTGCTAGCAGTGGCTGG + Intronic
1108546231 13:51497580-51497602 CCTGTCAAACTGTCAGTGGCAGG - Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1114508399 14:23235611-23235633 GCTGTCAAGCTGTCAGTTGCAGG - Intronic
1114779558 14:25522798-25522820 CCTTTTAAATTTTCAGTAGCTGG + Intergenic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1118006647 14:61569414-61569436 CCTTGTAAGCTGTATCTGGCTGG - Intronic
1119204394 14:72783415-72783437 TCATTCAAGCTGTCAGTTGCAGG - Intronic
1120113151 14:80582025-80582047 CCTATTCAGATGTCAGTGACAGG - Intronic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1125923621 15:43542709-43542731 GCTCTTACTCTGTCAGTGGCTGG + Intronic
1125957351 15:43799655-43799677 CCTACTAAGTTGTCAGTGGGCGG - Exonic
1126476117 15:49066924-49066946 CCTTATAAGCTTTCAATGTCTGG - Intergenic
1130091167 15:80822491-80822513 CCCTTTAAGCTGTCACTGTCCGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1131780109 15:95846799-95846821 ACTTTTAATCTGTGAGTGGTGGG + Intergenic
1133894503 16:9913077-9913099 CACTTTAAGCTATCAGTGGAAGG - Intronic
1139007915 16:62595905-62595927 CCTTTTCAATTCTCAGTGGCAGG + Intergenic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1140358026 16:74322427-74322449 CCTTGTAAGCTGTCACATGCTGG - Intergenic
1141214976 16:82014974-82014996 CCTTTTAAGCTTCCAGTTACAGG - Intergenic
1144958402 17:19031277-19031299 CCTGTAAAGCTGTCAGAGGTGGG - Intronic
1144976756 17:19143247-19143269 CCTGTAAAGCTGTCAGAGGTGGG + Intronic
1148285518 17:46387553-46387575 TCTTAAAAGCTGTCAGAGGCTGG + Intergenic
1148307681 17:46605153-46605175 TCTTAAAAGCTGTCAGAGGCTGG + Intronic
1152374109 17:79909409-79909431 AATTTTGAGCTGGCAGTGGCAGG + Intergenic
1155364766 18:25038948-25038970 CCTTCAAAGCCTTCAGTGGCTGG + Intergenic
1159664267 18:71138664-71138686 GATTTCAAGCTGTCAGTGTCTGG - Intergenic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
1164966506 19:32489485-32489507 TCTTTTAAACTGTCTGTGGTAGG - Intergenic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
925752743 2:7104544-7104566 TGTTTTAAGCTGTCAGTAGTTGG + Intergenic
927045106 2:19270265-19270287 CCTTTTAAAGTGGCAGAGGCTGG + Intergenic
931450189 2:62362128-62362150 CATTTTAAGCTGTAAGTTGGTGG + Intergenic
934066252 2:88344810-88344832 TCTTCCAAGCTGGCAGTGGCAGG - Intergenic
934944205 2:98525238-98525260 TCTTCAAAGCTGGCAGTGGCAGG + Intronic
935030147 2:99313772-99313794 CTCTTTAAACTGTCAATGGCAGG - Intronic
937073847 2:119086712-119086734 CAATTTGAGCTGTCAGTGGAGGG + Intergenic
941252041 2:163177813-163177835 CCTTTCAAGCTGTCAGAGCTTGG + Intergenic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1179175517 21:39005168-39005190 GCTTTTATGCTTTCAGAGGCAGG + Intergenic
1179197535 21:39179430-39179452 ATTTTTAAGGTGTCAGTGGTAGG - Intronic
1182468971 22:30535449-30535471 CCATGAAAGCTGCCAGTGGCGGG + Intronic
1182832214 22:33313421-33313443 CCTGTTTACCTGTCAGTGACAGG + Intronic
1184643644 22:45884965-45884987 CCTCTCCAGCTGTCAGTGACAGG - Intergenic
1185259190 22:49852373-49852395 CCTTTTTGGGTGTCAGTGCCTGG + Intergenic
949624356 3:5850435-5850457 CCTATTAAGCGTTGAGTGGCTGG - Intergenic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
953897023 3:46810809-46810831 CCTTTTAAGCTGTCCCTCCCTGG - Intronic
954577928 3:51686973-51686995 CTTGTGAAGCTGTCAGGGGCCGG - Intronic
958100253 3:88999591-88999613 ACACTTAAGCTGTCTGTGGCTGG + Intergenic
964373863 3:156030209-156030231 ATTTTAAAGCTGTCTGTGGCCGG - Intergenic
966269352 3:178085793-178085815 CCTTCCAAGCTGTCTGTGACTGG + Intergenic
967402801 3:189082764-189082786 CCTTTTAAAGTGTCAGTTACAGG - Intronic
971453517 4:26822136-26822158 TGTCTTAAGCTGTCAGTCGCTGG + Intergenic
974697367 4:65393499-65393521 CCTTCTTAGCTGACTGTGGCTGG + Intronic
984635151 4:182102207-182102229 CCTCTTATGCTGTCACTAGCTGG - Intergenic
984755136 4:183318980-183319002 CCTTCTATACTGTCAGAGGCAGG - Exonic
985065964 4:186122217-186122239 TCTTTAAAACTGTCAGTGTCAGG + Intronic
986164138 5:5258784-5258806 GCTTTTAATCTGGGAGTGGCAGG + Intronic
989151251 5:38301904-38301926 CCTTTGAGGCTGTCAGGGGAGGG - Intronic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
991077421 5:62556439-62556461 CATTTTAAGGTTTCAGTGGCTGG + Intronic
997573379 5:134952545-134952567 CCTCTAAACCTGTAAGTGGCAGG - Intronic
997634605 5:135395949-135395971 CCTGTTATGTTTTCAGTGGCAGG + Intronic
1001542348 5:172548400-172548422 TCTTTCTAGCTGTCAGAGGCTGG - Intergenic
1001961747 5:175883863-175883885 CCTTTCAATGTGTCAGTGCCTGG + Exonic
1002200875 5:177527372-177527394 CCTTAAAAGCCATCAGTGGCTGG - Intronic
1004537342 6:16515460-16515482 CCTGGGAATCTGTCAGTGGCTGG + Intronic
1006406489 6:33848677-33848699 CCTTTGGAGCTGACAGGGGCAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1013111442 6:107068373-107068395 CATTATAAGCTGTGAGGGGCTGG + Exonic
1013273144 6:108560742-108560764 CCTTTAAAGCGGGCAGCGGCCGG - Intronic
1013695676 6:112700211-112700233 CCTTTTAAGACATCATTGGCTGG + Intergenic
1014867642 6:126551315-126551337 CTTTTTAAGATGTCACTGACAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018842789 6:167530525-167530547 CCTTTTTATCTGAAAGTGGCAGG - Intergenic
1021083024 7:16385993-16386015 ACATTTAAGCTGTCTGTGGACGG - Intronic
1021217009 7:17928656-17928678 GATTTTAAGATGTTAGTGGCGGG - Intronic
1022448039 7:30485952-30485974 CTTTTTAACCTGTCTATGGCAGG + Intergenic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1026459351 7:70599789-70599811 CCTTCTAAGTTGTCTGTGGTGGG + Intronic
1027670884 7:81096787-81096809 CCTTTTAAGATGTCACTTGAAGG + Intergenic
1029183332 7:98720369-98720391 CCTTTTCAGCTTCCAGGGGCTGG + Intergenic
1029369964 7:100143310-100143332 AATTTTAAGATCTCAGTGGCCGG + Intergenic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1037838325 8:22227566-22227588 CCTCTCAAGCTGGCAGAGGCAGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1043245865 8:78000334-78000356 GCTTTAAAGTTGTCAGTGTCAGG - Intergenic
1045032825 8:98153931-98153953 CATGTTCAGATGTCAGTGGCAGG - Intronic
1050081400 9:1919559-1919581 ACTTTTAAGGTGTCAGACGCTGG - Intergenic
1053318515 9:37074024-37074046 TCTTCAAAACTGTCAGTGGCAGG - Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1058179797 9:101783144-101783166 CATTTTTAGGTGTCAGTGTCAGG + Intergenic
1058441698 9:105014400-105014422 TGTTTAATGCTGTCAGTGGCAGG + Intergenic
1058480256 9:105385801-105385823 CCTTTTTAACTGTCAGTGTTTGG + Intronic
1060507633 9:124209887-124209909 CATTTGAAGCTGGCAGTGGCTGG - Intergenic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1061858525 9:133456060-133456082 CCTTTTCAGGTGCCTGTGGCAGG + Exonic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186220793 X:7347176-7347198 CCTTTGGAGATGTCAGTTGCTGG + Intronic
1187564528 X:20435188-20435210 CCTTTTGTGATGTCAGAGGCTGG + Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1194776180 X:97968018-97968040 CCTTGTGAGATATCAGTGGCTGG - Intergenic
1199033048 X:143023199-143023221 CATTTTAAGCTGTCTAAGGCAGG - Intergenic
1201516040 Y:14819520-14819542 CCCTTCAAGCTGTCAGGGGAGGG - Intronic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic