ID: 1176875681

View in Genome Browser
Species Human (GRCh38)
Location 21:14124658-14124680
Sequence CCTTTTAAGCTGTCAGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 4, 3: 9, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176875681_1176875687 14 Left 1176875681 21:14124658-14124680 CCGGACACTGACAGCTTAAAAGG 0: 1
1: 1
2: 4
3: 9
4: 140
Right 1176875687 21:14124695-14124717 GTCCGGGGCTCAGACTTTTCTGG 0: 2
1: 5
2: 7
3: 5
4: 75
1176875681_1176875685 -2 Left 1176875681 21:14124658-14124680 CCGGACACTGACAGCTTAAAAGG 0: 1
1: 1
2: 4
3: 9
4: 140
Right 1176875685 21:14124679-14124701 GGTGGCTGCTTTCTTTGTCCGGG 0: 11
1: 3
2: 6
3: 34
4: 219
1176875681_1176875684 -3 Left 1176875681 21:14124658-14124680 CCGGACACTGACAGCTTAAAAGG 0: 1
1: 1
2: 4
3: 9
4: 140
Right 1176875684 21:14124678-14124700 AGGTGGCTGCTTTCTTTGTCCGG 0: 7
1: 1
2: 4
3: 20
4: 187
1176875681_1176875686 -1 Left 1176875681 21:14124658-14124680 CCGGACACTGACAGCTTAAAAGG 0: 1
1: 1
2: 4
3: 9
4: 140
Right 1176875686 21:14124680-14124702 GTGGCTGCTTTCTTTGTCCGGGG 0: 7
1: 7
2: 3
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176875681 Original CRISPR CCTTTTAAGCTGTCAGTGTC CGG (reversed) Intronic
904243142 1:29164208-29164230 CCTTTTCATCTGTTGGTGTCTGG - Intronic
906184004 1:43846578-43846600 CTTTTTAACCTGTTTGTGTCAGG + Intronic
906588981 1:47005799-47005821 CATTTTGAGATGTCAGTGTTTGG + Intergenic
907446479 1:54511202-54511224 CCTTGTCAGATGTCACTGTCAGG - Intergenic
910921004 1:92346928-92346950 CTTTTTGACCTGTGAGTGTCTGG - Intronic
912200600 1:107453371-107453393 CCTTTTTGACTGTCAGTTTCTGG - Intronic
914684004 1:149961970-149961992 CCTTCTACTCTGTCAGTGTGCGG - Intronic
920111010 1:203587125-203587147 CCTCCTAAGGTGTCTGTGTCTGG - Intergenic
920139416 1:203796847-203796869 CCTTTTAAAATGTGAGTGGCTGG - Exonic
920873332 1:209812293-209812315 GGGTTTAGGCTGTCAGTGTCTGG - Intergenic
921605416 1:217147297-217147319 GCTTTTAATCTGTAAGTATCTGG - Intergenic
921762355 1:218930720-218930742 CCTGCTCAGCTGTCAGTGTTTGG + Intergenic
922424276 1:225479129-225479151 CCTTTTAAACAGTCAGTCTTTGG + Intergenic
922982161 1:229836196-229836218 CCATTTAGGCTGTCAGTGAGCGG + Intergenic
923508515 1:234627987-234628009 CCATTTAAGGTGTCTGTGCCTGG - Intergenic
1063131381 10:3180580-3180602 TCTTTGAAGCTGGCAGTGGCTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1066366985 10:34786744-34786766 CCTAGTAAGCAGTAAGTGTCAGG - Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1069837411 10:71318205-71318227 CCATTGAGGCTGTCAGTGTGTGG - Intergenic
1074988786 10:118683200-118683222 CCTTTTAAGGAGCCAGTTTCAGG + Exonic
1076067549 10:127460728-127460750 CGTTTTTAGCTGTCAGTTTTTGG - Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1087541309 11:99524209-99524231 GCTTTTAATCTGGCATTGTCAGG + Intronic
1089714865 11:120349245-120349267 CCTTTTAAGCTATAATTGTATGG - Intronic
1091158939 11:133401805-133401827 TCTTTTAAGCTTTCAGTGAGTGG + Intronic
1091189067 11:133674726-133674748 CCTTCTAACCTGTCATTTTCAGG + Intergenic
1097363572 12:58685576-58685598 CCTTTTAAACTGTTCCTGTCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108546231 13:51497580-51497602 CCTGTCAAACTGTCAGTGGCAGG - Intergenic
1114233250 14:20802523-20802545 TCTTTTATGATGCCAGTGTCAGG - Intronic
1115676203 14:35677895-35677917 TCTTTTAGGGCGTCAGTGTCAGG - Intronic
1117990987 14:61433316-61433338 CCTTTTAAGCTCTCAAGTTCTGG - Intronic
1120113151 14:80582025-80582047 CCTATTCAGATGTCAGTGACAGG - Intronic
1121812709 14:96905544-96905566 CCTTTTAAACTCACAGGGTCAGG + Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1125838678 15:42777563-42777585 CCTTTCCAGGTTTCAGTGTCAGG - Intronic
1126476117 15:49066924-49066946 CCTTATAAGCTTTCAATGTCTGG - Intergenic
1129536247 15:76315624-76315646 CCTGTCAGGCTGGCAGTGTCTGG + Intergenic
1130091167 15:80822491-80822513 CCCTTTAAGCTGTCACTGTCCGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130623970 15:85494276-85494298 CCTTTTCAGCTGTTAGTCTGAGG - Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1137740296 16:50764161-50764183 CCCTTTTAGCTGTCCTTGTCTGG + Intronic
1137934449 16:52620999-52621021 CCTTTCAAGCTGGCAGTTTTTGG - Intergenic
1141214976 16:82014974-82014996 CCTTTTAAGCTTCCAGTTACAGG - Intergenic
1145112184 17:20173624-20173646 CGTTTTAAACTGTAATTGTCAGG + Intronic
1146097815 17:29949215-29949237 CATTTTCAGCTCTCAGTGTATGG - Intronic
1156335383 18:36166679-36166701 CCTTTTAAGATTTAAGTGTAAGG - Intronic
1158845221 18:61434960-61434982 CCTTTTATTATGACAGTGTCTGG + Intronic
1159664267 18:71138664-71138686 GATTTCAAGCTGTCAGTGTCTGG - Intergenic
1163146256 19:15380671-15380693 CCCTCTAAGCTGGCAGGGTCGGG - Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
1166137693 19:40787220-40787242 CTTTCTGAGCTGTCACTGTCTGG - Intronic
1166858417 19:45795048-45795070 CCATTTGGGCTGTCACTGTCTGG + Intergenic
1167396629 19:49233743-49233765 CCTTTTTAGATGTGTGTGTCGGG - Intergenic
1168672755 19:58253825-58253847 TATTTTAAGGTGTCAGTGTTTGG - Intronic
932530092 2:72520947-72520969 CATTTTAAGCTCTCAGAGTATGG - Intronic
932543976 2:72687929-72687951 CATTTTAAGATGTCTGTGTGTGG - Intronic
932743969 2:74316065-74316087 TCATTTAAGCTCTCTGTGTCTGG - Intronic
933970800 2:87468555-87468577 CCTTTGCAGCTGTAAATGTCAGG + Intergenic
936322930 2:111481641-111481663 CCTTTGCAGCTGTAAATGTCAGG - Intergenic
938173559 2:129104009-129104031 CCTTGAATGCTGTCACTGTCAGG - Intergenic
938751795 2:134338664-134338686 CCTTTGAACCTGTCTTTGTCAGG + Intronic
938943334 2:136188390-136188412 CCTTTTAGGGTGGCAGTGTTGGG + Intergenic
939006490 2:136793748-136793770 CCTTCTTAGGTTTCAGTGTCAGG + Intronic
941158284 2:162004928-162004950 CCTTGTCAGCTGTAAGTTTCAGG + Intronic
941252041 2:163177813-163177835 CCTTTCAAGCTGTCAGAGCTTGG + Intergenic
945711742 2:213305806-213305828 CCTTTTAACATGTCTTTGTCTGG + Intronic
947065216 2:226216894-226216916 ACTGTTACGCTGTCAGTATCAGG - Intergenic
1172557069 20:35851613-35851635 CCTTTAACGATGTCAATGTCTGG + Intronic
1172601426 20:36186236-36186258 CCTTTTAAGCTGGAAGTATTTGG + Intronic
1174373603 20:50111287-50111309 ACTTTTTAACTGTCAGGGTCTGG + Intronic
1175023763 20:55879548-55879570 GTTTTTAAGCTGTCAGATTCTGG + Intergenic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1177332687 21:19682952-19682974 CCTTTTAATATGCCAGTGTAGGG - Intergenic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1181038872 22:20182591-20182613 CCCTTGAAGGTGTCCGTGTCAGG - Intergenic
1182832214 22:33313421-33313443 CCTGTTTACCTGTCAGTGACAGG + Intronic
1183055128 22:35300384-35300406 CCTTCTCAGGTGTCTGTGTCCGG - Intronic
1184041144 22:41944612-41944634 TCTTTTGAGCTGTCACTGTGAGG - Intronic
1184065642 22:42118428-42118450 CCTTTTACCATATCAGTGTCAGG - Intergenic
1184158555 22:42684709-42684731 CCTTGGAAGCTGCCTGTGTCAGG - Intergenic
1184643644 22:45884965-45884987 CCTCTCCAGCTGTCAGTGACAGG - Intergenic
1185259190 22:49852373-49852395 CCTTTTTGGGTGTCAGTGCCTGG + Intergenic
953897023 3:46810809-46810831 CCTTTTAAGCTGTCCCTCCCTGG - Intronic
955091634 3:55757477-55757499 CCTGTGAAACTGCCAGTGTCTGG + Intronic
956954632 3:74322476-74322498 AATTTTATGTTGTCAGTGTCTGG - Intronic
959655690 3:108801692-108801714 ACACTGAAGCTGTCAGTGTCTGG - Intergenic
966165936 3:177016433-177016455 CATTTGAAACTGTCAGTGTTTGG + Intergenic
966269352 3:178085793-178085815 CCTTCCAAGCTGTCTGTGACTGG + Intergenic
967402801 3:189082764-189082786 CCTTTTAAAGTGTCAGTTACAGG - Intronic
973762525 4:54132423-54132445 CCATTTAAGGTATCAGGGTCTGG - Intronic
974715183 4:65660425-65660447 CCTTTTAATCGTACAGTGTCAGG + Intronic
978103693 4:104875304-104875326 CCTTTGAGGCTATCATTGTCAGG - Intergenic
980787765 4:137576785-137576807 TTCATTAAGCTGTCAGTGTCAGG - Intergenic
984013566 4:174400744-174400766 CCTTTTATGCTACCAGTGTGGGG + Intergenic
985065964 4:186122217-186122239 TCTTTAAAACTGTCAGTGTCAGG + Intronic
985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG + Intergenic
985897147 5:2755413-2755435 CCTTATGAGCTTTCGGTGTCTGG + Intergenic
986316558 5:6592793-6592815 TCTGCTGAGCTGTCAGTGTCAGG - Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
991077421 5:62556439-62556461 CATTTTAAGGTTTCAGTGGCTGG + Intronic
997365644 5:133323588-133323610 CCAATGACGCTGTCAGTGTCAGG - Intronic
997743872 5:136281480-136281502 CCTAGTAAGATATCAGTGTCAGG - Intronic
998554674 5:143111827-143111849 CATTATATGCTGTCTGTGTCAGG + Intronic
1001327311 5:170738575-170738597 CCTTTTCAGGTGCCTGTGTCAGG + Intergenic
1001961747 5:175883863-175883885 CCTTTCAATGTGTCAGTGCCTGG + Exonic
1003426503 6:6001568-6001590 CCTTTGAAGCTGTCCAGGTCTGG + Intronic
1003805011 6:9718183-9718205 CCCGCTATGCTGTCAGTGTCTGG + Intronic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1014867642 6:126551315-126551337 CTTTTTAAGATGTCACTGACAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1026340003 7:69426933-69426955 CCTTTCAACCTGTCACTCTCTGG + Intergenic
1028348554 7:89814531-89814553 CCTTTAAAACTCTCAGTGTAAGG - Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1031670107 7:124531521-124531543 CCCAGTCAGCTGTCAGTGTCTGG - Intergenic
1032959643 7:137016448-137016470 CCTTATAAACTGTCAGTATTAGG + Exonic
1037951571 8:23021809-23021831 CCCTGTAAGATGTCACTGTCTGG - Exonic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040578427 8:48674862-48674884 CATTATAAACTCTCAGTGTCAGG + Intergenic
1043245865 8:78000334-78000356 GCTTTAAAGTTGTCAGTGTCAGG - Intergenic
1043737278 8:83764611-83764633 CCTTTAAAGGTGTCAGATTCTGG + Intergenic
1043971589 8:86535172-86535194 CCTTTTAATCTGCCAGTCTAAGG - Intronic
1043982510 8:86658178-86658200 GCTGTCAGGCTGTCAGTGTCTGG - Intronic
1044565241 8:93655345-93655367 CCTTTGAAACTGTGAGTGTGAGG + Intergenic
1047481259 8:125285597-125285619 CCTATAAAGCTCTTAGTGTCTGG + Intronic
1053561264 9:39197468-39197490 TATTTTAAGCTGTCTGTGTGTGG + Intronic
1053825357 9:42017706-42017728 TATTTTAAGCTGTCTGTGTGTGG + Intronic
1054135855 9:61421479-61421501 TATTTTAAGCTGTCTGTGTGTGG - Intergenic
1054605206 9:67169651-67169673 TATTTTAAGCTGTCTGTGTGTGG - Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1058179797 9:101783144-101783166 CATTTTTAGGTGTCAGTGTCAGG + Intergenic
1058480256 9:105385801-105385823 CCTTTTTAACTGTCAGTGTTTGG + Intronic
1059042307 9:110827914-110827936 CTTTCTAATCTGTCCGTGTCTGG - Intergenic
1060507633 9:124209887-124209909 CATTTGAAGCTGGCAGTGGCTGG - Intergenic
1062021367 9:134320966-134320988 GTTTTTAAGCTGAGAGTGTCAGG + Intronic
1185856294 X:3539216-3539238 CCTTTTTAGGTCTCAGTTTCTGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1190434454 X:50409604-50409626 TCTTTAAAGCTTTCAGTGTGTGG + Intronic
1193249659 X:79274644-79274666 CATGTTAGGCTGTCTGTGTCTGG - Intergenic
1193928244 X:87517885-87517907 CCTGCTACGATGTCAGTGTCTGG + Exonic
1195956325 X:110334880-110334902 CCTTATAACCTGAGAGTGTCTGG + Intronic
1196603272 X:117626088-117626110 CCTTCTAAGCTATCACTCTCTGG - Intergenic
1197341382 X:125270264-125270286 CATTTTATGTTGTCAGTGTTTGG + Intergenic
1198723172 X:139647053-139647075 CCTTTTAAACTTAAAGTGTCAGG - Intronic