ID: 1176876188

View in Genome Browser
Species Human (GRCh38)
Location 21:14131265-14131287
Sequence GCCCCAGTGCTAGTTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176876188_1176876193 -3 Left 1176876188 21:14131265-14131287 CCAGGACCAACTAGCACTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1176876193 21:14131285-14131307 GGCCAGTATAGGCTGTTCTGGGG 0: 1
1: 0
2: 2
3: 16
4: 140
1176876188_1176876195 9 Left 1176876188 21:14131265-14131287 CCAGGACCAACTAGCACTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1176876195 21:14131297-14131319 CTGTTCTGGGGCCTAAAAACAGG 0: 1
1: 4
2: 7
3: 22
4: 140
1176876188_1176876192 -4 Left 1176876188 21:14131265-14131287 CCAGGACCAACTAGCACTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1176876192 21:14131284-14131306 GGGCCAGTATAGGCTGTTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 98
1176876188_1176876191 -5 Left 1176876188 21:14131265-14131287 CCAGGACCAACTAGCACTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1176876191 21:14131283-14131305 GGGGCCAGTATAGGCTGTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176876188 Original CRISPR GCCCCAGTGCTAGTTGGTCC TGG (reversed) Intronic
900138461 1:1128749-1128771 GCCTCAGTCCTACCTGGTCCTGG - Intergenic
900869074 1:5289089-5289111 GGCCCACTGCTAGGTGGACCTGG - Intergenic
902362322 1:15948722-15948744 GCCCCAGTGCTTTTTGGTTTGGG - Intronic
907048219 1:51312984-51313006 GCCCCAGAGGCAGCTGGTCCTGG + Intronic
907297676 1:53465745-53465767 GCCCCAGTGCTGGGTGGCCTGGG + Intronic
907727700 1:57035229-57035251 GACCCAGAGCTAGTTGGTAGGGG - Intronic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919450386 1:197765627-197765649 GCCACAGTGCAAGTTTGTTCAGG - Intronic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
920785086 1:209033560-209033582 GCCTCAGTCCCACTTGGTCCTGG - Intergenic
1064565026 10:16631324-16631346 GCCCCAGTGCCAGTGCGCCCTGG - Intronic
1066564591 10:36707763-36707785 GCCCCAGTGTTAATTGGTACTGG + Intergenic
1071524082 10:86348046-86348068 ACCCCAGTGATAGGTGGTCCAGG - Intronic
1076418165 10:130307407-130307429 TCCCCAGTGGTAGTTGGTGCTGG + Intergenic
1076804361 10:132847672-132847694 GCCTCAGTGCTGGCTGGTTCCGG - Intronic
1084904293 11:72334266-72334288 GCCCCTGTGCTGGCTGGCCCAGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1088741988 11:112774802-112774824 GCCTCAGAGCTAGTTCTTCCTGG + Intergenic
1088847821 11:113682570-113682592 GCCACTGTCCTAGTTTGTCCAGG + Intergenic
1090208409 11:124898316-124898338 TCCCCAGTGCCAGATGGACCAGG + Intronic
1096900577 12:54875888-54875910 GCTCCAGTGTTTGTGGGTCCTGG - Intergenic
1097650594 12:62292865-62292887 GGCACAGTGCTAGTTAGACCCGG - Intronic
1097769083 12:63559624-63559646 GCCCCAAAGCTTGTTGGTCATGG - Exonic
1102021616 12:109687290-109687312 GGCCCAGTGCTGGTTGATTCCGG + Intergenic
1102796751 12:115695524-115695546 GCCCCAGTGTATGTTGTTCCTGG + Intergenic
1107708041 13:43126347-43126369 GGCCCAGTGCTCTGTGGTCCTGG - Intergenic
1118781857 14:69013925-69013947 GCCCCAGTGCTAGGCTGTCGAGG - Intergenic
1123121267 14:105918151-105918173 GCCCGAGTGCCAGGCGGTCCCGG + Intronic
1124355424 15:28991659-28991681 GCCCCAGTGCCAGCTCGACCTGG - Intronic
1128982300 15:72196910-72196932 GCCCCAGTGCTAGCTGGCCGAGG + Intronic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1132930497 16:2456654-2456676 GCGCCAGTGCCTGTGGGTCCTGG - Exonic
1133040628 16:3058413-3058435 GCCCCAGTTCTGGGTGTTCCAGG + Exonic
1133614799 16:7466077-7466099 GCCCCAGGGCTAGCTAATCCTGG - Intronic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1141930259 16:87197467-87197489 GGTCCAGTTGTAGTTGGTCCAGG + Intronic
1142138725 16:88463152-88463174 GCCCCAGGGCCAGGTGGTCGTGG + Intronic
1147612012 17:41807376-41807398 GCCCCACTGCTGTGTGGTCCTGG - Intronic
1152684817 17:81688778-81688800 GCCCAAGTACAAGGTGGTCCAGG + Exonic
1152699605 17:81812443-81812465 GCCCCAGGGCTATGTGGCCCAGG + Intronic
1154012701 18:10589274-10589296 GCCCCAGTGCTGGCCGTTCCTGG - Intergenic
1158412613 18:57221411-57221433 GTCCCACAGCTAGTTGGTCCCGG - Intergenic
1159447702 18:68560434-68560456 GACCCAATGTGAGTTGGTCCTGG - Intergenic
1162371774 19:10284139-10284161 CCCCCAGTGCCAGGTGGACCTGG - Exonic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1163426072 19:17241641-17241663 ACCCCAGGGGTAGTTGCTCCAGG - Intronic
1163823269 19:19508390-19508412 CCCACAGTGCTAGTTGTGCCTGG + Exonic
1166663128 19:44660176-44660198 GGCCCAGTGGTAGGCGGTCCTGG - Intronic
1167077611 19:47258868-47258890 GCCCCAGTGCTGAGTGGTGCTGG + Intronic
929231397 2:39564466-39564488 GCACCAGTTGTAGTGGGTCCAGG + Intergenic
936043139 2:109165090-109165112 CTCCCAGGGCTAGTTGTTCCTGG + Intronic
936140498 2:109935911-109935933 GCCTCTGTGCTAGTAGGTCTGGG + Intergenic
936177189 2:110233856-110233878 GCCTCTGTGCTAGTAGGTCTGGG + Intergenic
936204196 2:110435575-110435597 GCCTCTGTGCTAGTAGGTCTGGG - Intronic
936792769 2:116169282-116169304 GCCCCTGTGCTAGGTAGGCCAGG - Intergenic
937219337 2:120332818-120332840 GCCCCAGGGCTTGTTGGTTGGGG + Intergenic
937252899 2:120535298-120535320 ACCCCAGTGGAAGTTGGTTCTGG - Intergenic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
938399534 2:130977927-130977949 GCCCTAGTTTTAGTTGGTCAGGG - Intronic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
1172969803 20:38865119-38865141 GCCCAAGTGTTAGATGATCCTGG + Intronic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176876188 21:14131265-14131287 GCCCCAGTGCTAGTTGGTCCTGG - Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1178711814 21:34923935-34923957 TCCCCAGTGCCAGGAGGTCCTGG + Intronic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1180108889 21:45638270-45638292 GGCCTAGTCCTAGGTGGTCCGGG + Intergenic
1181953266 22:26570262-26570284 CTCCCAGGGCTAGTCGGTCCTGG + Intronic
1183290486 22:36999120-36999142 GTCCCAGTTCTACTGGGTCCTGG + Intronic
949463480 3:4319389-4319411 TCCCCAGTTGTAGTTGGTCAGGG - Intronic
950205135 3:11074258-11074280 GCCCCAGTTTTAGTAGGTCAGGG + Intergenic
951266862 3:20577760-20577782 GTCCTAGTGCTAGATGGACCTGG - Intergenic
951333923 3:21398699-21398721 GCCCCAGGGCCACTGGGTCCAGG - Intergenic
952900870 3:38111021-38111043 GAACCAGTGCTAGCTGGTTCTGG - Intronic
961450411 3:126999951-126999973 ACCCCAGGGTTAGATGGTCCAGG + Intronic
965727361 3:171732384-171732406 GCCCCAGTGCAAGCTGCTGCTGG + Intronic
969636295 4:8371078-8371100 GACCCGTTGCTAGTGGGTCCTGG - Intronic
974257637 4:59481529-59481551 TCACCAGTGCCATTTGGTCCTGG - Intergenic
975495322 4:75030236-75030258 GACCCAGTACTATTTAGTCCTGG - Intronic
981727910 4:147867379-147867401 CTCTCAGTGCTAGTTGATCCTGG + Intronic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
985792568 5:1938205-1938227 GTCCCTGTGCTAGTTGGGGCTGG - Intergenic
986033096 5:3911487-3911509 GCCTCAGTCCAATTTGGTCCAGG - Intergenic
994871981 5:105362732-105362754 GCTCCAGTGTTAGTGGGTCTAGG - Intergenic
995180308 5:109224636-109224658 TCCCCAGGGCGAGTTGCTCCTGG - Intergenic
995991813 5:118248169-118248191 GCTCTAGTGTTAGTGGGTCCAGG - Intergenic
999368375 5:151037780-151037802 GCCCGAGTCCAAGTTGGGCCAGG - Intronic
1009721421 6:67475652-67475674 GCCCCAGTGCTGGCTGTTACTGG - Intergenic
1015886613 6:137924541-137924563 GCTCCAAAGCTAGGTGGTCCAGG - Intergenic
1018707830 6:166475799-166475821 GCCCCCGTGTGAGTTGCTCCAGG - Intronic
1022928360 7:35080702-35080724 GCCCCAAAGCTTGTTGGTCATGG - Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1024098487 7:46005603-46005625 GCCCCAGTCTTAATTCGTCCAGG - Intergenic
1026972102 7:74474779-74474801 GCCTCAGGGCTAGCTGGGCCTGG - Intronic
1035307903 7:157945161-157945183 GCCCCAGTGCTGGGTGTTCAGGG + Intronic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1044611071 8:94092656-94092678 TGCCCAGTGCTACTTGGTCAGGG + Intergenic
1049192217 8:141294758-141294780 GCCCCAGGCCCAGTTGGTGCGGG + Intronic
1049867974 8:144950973-144950995 GCCTCAGGGCTAGTGGGACCAGG - Intergenic
1055990799 9:82102980-82103002 GACCAAGAGCTGGTTGGTCCTGG + Intergenic
1057363862 9:94400182-94400204 TCCCCAGTTTTAGTTGGTCGAGG - Intronic
1057659472 9:96987892-96987914 TCCCCAGTTTTAGTTGGTCGAGG + Intronic
1059175822 9:112169497-112169519 GCCCCACTGCTGGTTGATCTTGG - Intronic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1193017313 X:76750013-76750035 GTCCTGGTGCTAGTGGGTCCAGG - Intergenic
1196022300 X:111002974-111002996 GCCCCAGCCCCAGTTGGTCCAGG - Intronic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic