ID: 1176898689

View in Genome Browser
Species Human (GRCh38)
Location 21:14414815-14414837
Sequence GGTGCATAAACTCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176898683_1176898689 13 Left 1176898683 21:14414779-14414801 CCAAAAATGAGGTGCCAACTGAT No data
Right 1176898689 21:14414815-14414837 GGTGCATAAACTCACCATGCAGG No data
1176898686_1176898689 -10 Left 1176898686 21:14414802-14414824 CCCCAGAGTGCTAGGTGCATAAA No data
Right 1176898689 21:14414815-14414837 GGTGCATAAACTCACCATGCAGG No data
1176898684_1176898689 -1 Left 1176898684 21:14414793-14414815 CCAACTGATCCCCAGAGTGCTAG No data
Right 1176898689 21:14414815-14414837 GGTGCATAAACTCACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176898689 Original CRISPR GGTGCATAAACTCACCATGC AGG Intergenic
No off target data available for this crispr