ID: 1176901611

View in Genome Browser
Species Human (GRCh38)
Location 21:14449053-14449075
Sequence CAGTAGGGGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176901611_1176901618 -1 Left 1176901611 21:14449053-14449075 CCCTCCTCACTCTGCCCCTACTG No data
Right 1176901618 21:14449075-14449097 GAAGCCTACAGGTGCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176901611 Original CRISPR CAGTAGGGGCAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr