ID: 1176901618

View in Genome Browser
Species Human (GRCh38)
Location 21:14449075-14449097
Sequence GAAGCCTACAGGTGCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176901612_1176901618 -2 Left 1176901612 21:14449054-14449076 CCTCCTCACTCTGCCCCTACTGA No data
Right 1176901618 21:14449075-14449097 GAAGCCTACAGGTGCAGAAATGG No data
1176901610_1176901618 4 Left 1176901610 21:14449048-14449070 CCTCACCCTCCTCACTCTGCCCC No data
Right 1176901618 21:14449075-14449097 GAAGCCTACAGGTGCAGAAATGG No data
1176901611_1176901618 -1 Left 1176901611 21:14449053-14449075 CCCTCCTCACTCTGCCCCTACTG No data
Right 1176901618 21:14449075-14449097 GAAGCCTACAGGTGCAGAAATGG No data
1176901613_1176901618 -5 Left 1176901613 21:14449057-14449079 CCTCACTCTGCCCCTACTGAAGC No data
Right 1176901618 21:14449075-14449097 GAAGCCTACAGGTGCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176901618 Original CRISPR GAAGCCTACAGGTGCAGAAA TGG Intergenic
No off target data available for this crispr