ID: 1176901682

View in Genome Browser
Species Human (GRCh38)
Location 21:14449753-14449775
Sequence CTACTTCATATTTGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176901682_1176901684 22 Left 1176901682 21:14449753-14449775 CCAGCATTTCAAATATGAAGTAG No data
Right 1176901684 21:14449798-14449820 TAAGTGAAGTGCATGAAATTGGG No data
1176901682_1176901686 24 Left 1176901682 21:14449753-14449775 CCAGCATTTCAAATATGAAGTAG No data
Right 1176901686 21:14449800-14449822 AGTGAAGTGCATGAAATTGGGGG No data
1176901682_1176901685 23 Left 1176901682 21:14449753-14449775 CCAGCATTTCAAATATGAAGTAG No data
Right 1176901685 21:14449799-14449821 AAGTGAAGTGCATGAAATTGGGG No data
1176901682_1176901683 21 Left 1176901682 21:14449753-14449775 CCAGCATTTCAAATATGAAGTAG No data
Right 1176901683 21:14449797-14449819 TTAAGTGAAGTGCATGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176901682 Original CRISPR CTACTTCATATTTGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr