ID: 1176901701

View in Genome Browser
Species Human (GRCh38)
Location 21:14450088-14450110
Sequence CACAGTGGATGAGAGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176901701_1176901705 26 Left 1176901701 21:14450088-14450110 CCATATGACTCTCATCCACTGTG No data
Right 1176901705 21:14450137-14450159 TAAAAATGGCATGTATTCTCTGG No data
1176901701_1176901704 12 Left 1176901701 21:14450088-14450110 CCATATGACTCTCATCCACTGTG No data
Right 1176901704 21:14450123-14450145 ACATCTGCTCTAGCTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176901701 Original CRISPR CACAGTGGATGAGAGTCATA TGG (reversed) Intergenic
No off target data available for this crispr