ID: 1176904271

View in Genome Browser
Species Human (GRCh38)
Location 21:14480783-14480805
Sequence CAAAGCAGCATTTCCTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176904271_1176904275 -5 Left 1176904271 21:14480783-14480805 CCCTATGAGGAAATGCTGCTTTG No data
Right 1176904275 21:14480801-14480823 CTTTGCACTCAGGCCCATCAGGG No data
1176904271_1176904276 6 Left 1176904271 21:14480783-14480805 CCCTATGAGGAAATGCTGCTTTG No data
Right 1176904276 21:14480812-14480834 GGCCCATCAGGGACCCCAGAAGG No data
1176904271_1176904274 -6 Left 1176904271 21:14480783-14480805 CCCTATGAGGAAATGCTGCTTTG No data
Right 1176904274 21:14480800-14480822 GCTTTGCACTCAGGCCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176904271 Original CRISPR CAAAGCAGCATTTCCTCATA GGG (reversed) Intergenic
No off target data available for this crispr