ID: 1176905317

View in Genome Browser
Species Human (GRCh38)
Location 21:14493373-14493395
Sequence CTATTGTCCTTGGGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176905317_1176905322 14 Left 1176905317 21:14493373-14493395 CCCATTTTCCCCAAGGACAATAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176905322 21:14493410-14493432 GACACAATTTTAAGACACATTGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176905317 Original CRISPR CTATTGTCCTTGGGGAAAAT GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901051209 1:6426693-6426715 CTATTGGCCTTGGGGACTGTGGG - Intronic
903461560 1:23524481-23524503 CTTTTGGCCTTGGAGAAAAGGGG + Exonic
904221447 1:28973301-28973323 CTGGTGTCCTTGGGGATATTGGG + Intronic
909269914 1:73609876-73609898 CTTTTGACCTTGTGGCAAATAGG + Intergenic
909520175 1:76558842-76558864 GTATAGCTCTTGGGGAAAATTGG + Intronic
910351431 1:86303216-86303238 AAACTGTCCTTGTGGAAAATTGG - Intergenic
910598683 1:89006845-89006867 ATATTCCCTTTGGGGAAAATTGG + Exonic
911246168 1:95520287-95520309 CTATAGGTCTAGGGGAAAATTGG + Intergenic
911264687 1:95729403-95729425 TTATTGTACTTGGGGTAGATAGG + Intergenic
912892371 1:113548402-113548424 CTATTATTTGTGGGGAAAATGGG - Intronic
912937412 1:114015579-114015601 CTGTTTTCCTTGAGGCAAATAGG - Intergenic
913611446 1:120513389-120513411 CAATTGCCCTGGGGGAAAAAAGG - Intergenic
913983347 1:143543433-143543455 CAATTGCCCTGGGGGAAAAAAGG + Intergenic
914579746 1:149008850-149008872 CAATTGCCCTGGGGGAAAAAAGG + Intronic
915339077 1:155166648-155166670 TTATTGTCCTTGGTGAGAACAGG - Intergenic
916537679 1:165719201-165719223 CTAATGTCTTTCTGGAAAATTGG + Intergenic
920941049 1:210483009-210483031 CTTTTGTGCTTGGGGATATTGGG + Intronic
924117173 1:240759510-240759532 ATATTCTCCCTGGGGAAAAGAGG - Intergenic
1063567800 10:7186718-7186740 CTATTTTCTTTGGTGCAAATGGG - Intronic
1063703256 10:8406386-8406408 TCCTTGTTCTTGGGGAAAATGGG + Intergenic
1068257499 10:54532374-54532396 CTATTTTGCTTTGGGAAAAGAGG - Intronic
1071402840 10:85294164-85294186 CTATTACCATTGGGGGAAATGGG - Intergenic
1078027038 11:7706210-7706232 CCATGTTCCTTTGGGAAAATAGG - Intronic
1079779789 11:24587067-24587089 CTACTTTCCTTGCAGAAAATTGG + Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1084725319 11:70938111-70938133 GATTTGTCCTTGGGGAAACTGGG - Intronic
1086357044 11:86012385-86012407 CTATTAACCTAGGGAAAAATTGG + Exonic
1087690988 11:101320522-101320544 CTATTTTGCCTGGGGAAAGTGGG - Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090094712 11:123731096-123731118 CTATGGTGGTTGGGGAAAAGAGG - Intronic
1090499788 11:127250314-127250336 CAACTGTCCTTTGGGAAAGTGGG + Intergenic
1090714621 11:129419366-129419388 CAATTGGCCTGTGGGAAAATTGG + Intronic
1091848632 12:3677645-3677667 CTGTTGTCCTTGGAGAAGCTGGG + Intronic
1093649784 12:21629824-21629846 CTATTCTCTTTGGTGAAAAATGG + Intergenic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1095796990 12:46230585-46230607 GTCTTCTCCATGGGGAAAATAGG + Intronic
1098241573 12:68472640-68472662 CTATTGTGCTGGGGGAGAGTTGG - Intergenic
1099209207 12:79764011-79764033 AAATTGTCTTTGGGGAAAAGTGG + Intergenic
1099228750 12:79999387-79999409 CTTATTTCCATGGGGAAAATTGG - Intergenic
1100402978 12:94248273-94248295 CTCTCTTCCATGGGGAAAATGGG + Exonic
1102724483 12:115048444-115048466 CCTTTGTCCTTGTGGAAAGTGGG + Intergenic
1108966020 13:56302920-56302942 CTATTGGAGTTGGGGAAAACTGG + Intergenic
1109561618 13:64057142-64057164 CTCATGCCCTTGGGGAAATTGGG - Intergenic
1111226237 13:85274815-85274837 CTATGGTTCTTGGGGAATAAGGG - Intergenic
1111993281 13:95137965-95137987 TTATTTTCTTTGGGGAAAGTGGG + Intronic
1112374700 13:98828154-98828176 CGAATGTCCTTGGGGAGAACTGG - Intronic
1115431275 14:33321479-33321501 ATATTCTGCTTGGGGAAATTTGG + Intronic
1118419946 14:65590854-65590876 AAATTCTCCATGGGGAAAATAGG + Intronic
1121293404 14:92795701-92795723 TTCTTGTTCTTGGGGAAAGTGGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122349104 14:101077472-101077494 CTAATGGGCTTGGGGAAAATGGG + Intergenic
1125540506 15:40467275-40467297 CTGTTGTCCTTGTGGAGACTAGG + Exonic
1126405613 15:48319695-48319717 CTAGTGTTCTTGGGGAAAGTGGG + Intergenic
1126531088 15:49711814-49711836 CTATTTTCCATGGGGAAATTTGG - Intergenic
1126793629 15:52242775-52242797 TTATTCTGCTTGGGGAAAGTGGG + Intronic
1128093656 15:64936252-64936274 CTATTTACATGGGGGAAAATGGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1130658752 15:85813115-85813137 CTATTACCCTTGGAGAAAACTGG + Intergenic
1138094346 16:54200346-54200368 CTAATGTGCTTGGGGAAGGTAGG - Intergenic
1139630635 16:68230037-68230059 CCATTGTCTTTGGGGGAAACAGG + Exonic
1143809303 17:9457880-9457902 CTATTCTCCTTGTCAAAAATTGG - Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1149453251 17:56766549-56766571 CTAATGTCCTTGGGGGCAACAGG + Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1155826530 18:30450970-30450992 CTATTTTTCTTGGGGAAAATGGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156956284 18:42968476-42968498 CCTTTGATCTTGGGGAAAATGGG - Intronic
1157606547 18:48929645-48929667 GTTTTGTCCTTTTGGAAAATTGG - Intronic
1157881321 18:51323617-51323639 CAATTGTCTTTAAGGAAAATGGG - Intergenic
1159535200 18:69706444-69706466 CTATTCTCCCTGTTGAAAATGGG - Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1162161476 19:8721109-8721131 CAATTAACCATGGGGAAAATGGG - Intergenic
1163362636 19:16856953-16856975 CTACTATCCCTGGGGTAAATGGG - Intronic
925096970 2:1213344-1213366 CTATTAGCCTATGGGAAAATTGG - Intronic
926678034 2:15642873-15642895 ATCTTGTCCTTCTGGAAAATGGG - Intergenic
928287825 2:30008776-30008798 CTAGTGTCTTTGGAGAAAAAGGG - Intergenic
929177856 2:39000015-39000037 CTAGTGTCTGTGGGGATAATGGG + Intronic
929205871 2:39292234-39292256 TTATTGTCCTTTGGAAAAAATGG + Intronic
931472638 2:62554484-62554506 TTATATTTCTTGGGGAAAATGGG - Intergenic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
931973006 2:67611193-67611215 ATATTCTCCTTTGGCAAAATAGG + Intergenic
932643074 2:73470514-73470536 CTATTGTGCTTGGGAAAAAAAGG + Intronic
933157893 2:78994274-78994296 CTAGTATCTTTGGGGAAAACTGG - Intergenic
937175042 2:119922283-119922305 TTACTGCCCTTGGGGAAGATTGG + Intronic
937295070 2:120805180-120805202 CTGTTGTGCTTGGGGAAATGGGG - Intronic
939314330 2:140528500-140528522 CTATTGTTATTTTGGAAAATAGG - Intronic
940349067 2:152660850-152660872 CTCTTGAACTGGGGGAAAATAGG + Intronic
941274724 2:163476892-163476914 CAAATGTCCATGGGGAAAAGTGG - Intergenic
942132066 2:172890299-172890321 CAATTGTCCTTGGGGACTATTGG + Intronic
945402428 2:209401488-209401510 CCATTGGCCTTGGGGAAAACTGG + Intergenic
1172920489 20:38477664-38477686 CTATTTCTCTTGGGAAAAATAGG - Intronic
1173454508 20:43191548-43191570 CTATAGCCCTTAGGGACAATTGG + Intergenic
1173716067 20:45207407-45207429 CTTTTGTCCGTGTGGAAATTGGG - Exonic
1173717486 20:45221742-45221764 CTTTTGTCCATGTGGAAATTGGG - Exonic
1174105455 20:48159154-48159176 ATATTCTGCTTGGGGAAAACAGG + Intergenic
1174657996 20:52187703-52187725 TTATTTAACTTGGGGAAAATTGG + Intronic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1176996996 21:15566875-15566897 CATTTGTCTTTGGGTAAAATGGG - Intergenic
1178752286 21:35316359-35316381 CTATGGTACTTGGGAAAACTGGG + Intronic
949847566 3:8387323-8387345 CTATGGTCCATGGGGAACAGTGG + Intergenic
951296501 3:20942522-20942544 CTATTATTGTTGGGGAAAAGGGG + Intergenic
951830465 3:26920692-26920714 CTATGGGACTTGGGGAAAATGGG - Intergenic
951969201 3:28424166-28424188 CTATTCTCCATGAAGAAAATAGG + Intronic
953164876 3:40456163-40456185 CTATGTTCCTTGGAGCAAATGGG - Intergenic
957477700 3:80748222-80748244 TTATTTTCCTTTGGGAATATAGG + Intergenic
959924531 3:111906683-111906705 CTATTATTCTTTGGGAGAATAGG + Intronic
960220844 3:115106580-115106602 CTATTGTCCTTGGGCCCGATGGG - Intronic
960305023 3:116050508-116050530 ATATGGTCCTTGGGGAAATTAGG + Intronic
964483245 3:157162418-157162440 ATATTATCATTGGGGAAAGTTGG + Intergenic
971739413 4:30501499-30501521 CTAATGTCCCTGGGCAAAGTGGG + Intergenic
972805171 4:42522594-42522616 ATTTTGTCCTGGGGAAAAATTGG - Intronic
972845846 4:42988210-42988232 GTTTTGTCCCTGGAGAAAATAGG + Intronic
973086382 4:46067040-46067062 ATATTTTCCTTCAGGAAAATTGG - Intronic
975294693 4:72719980-72720002 TGATTTTCCTTTGGGAAAATTGG + Intergenic
975499067 4:75065020-75065042 GTATTGTCCTTTGGAAAAAATGG - Intergenic
976391392 4:84508290-84508312 CTATTGCCATTGGAGAAACTAGG + Intergenic
977382367 4:96292040-96292062 CTATTATCATTGTGGAGAATGGG - Intergenic
978086004 4:104656058-104656080 GTATTGTCTTTGATGAAAATAGG - Intergenic
979356073 4:119707273-119707295 ATATTCTCATTGGGGGAAATGGG + Intergenic
980859835 4:138486054-138486076 CTCTTCTGCCTGGGGAAAATTGG - Intergenic
982044179 4:151425708-151425730 CTAGAGTCTTTGGAGAAAATGGG - Intronic
982596907 4:157397003-157397025 CTATTATCATTGGGGAAAACTGG + Intergenic
983921453 4:173349968-173349990 ATATTGTCATTGGAGAAAATGGG + Intergenic
984361471 4:178740302-178740324 ATATTGTTTTTGGGGAGAATGGG + Intergenic
985983827 5:3496455-3496477 CTATGATCCTTGGGGACAAAAGG + Intergenic
986293174 5:6416622-6416644 CCCTTGACCTTGGGGAAAAGAGG + Intergenic
991134482 5:63165344-63165366 CTCTGGTCCTTGGGGAGAAGTGG + Intergenic
991939834 5:71839861-71839883 CTCATGTCCTGGGGGACAATAGG - Intergenic
994148400 5:96420563-96420585 ATTTCTTCCTTGGGGAAAATGGG - Intronic
996117680 5:119635463-119635485 ATATAGCCCTTGGGGAAAAGGGG + Intronic
999030708 5:148288006-148288028 CTATTCTCCTTGGACAAAAAAGG - Intergenic
999525622 5:152402934-152402956 CTATTCACCTTAGGGACAATAGG + Intronic
999572626 5:152937841-152937863 CTCTTGTCCTTGCTGAAAAGAGG - Intergenic
1001693032 5:173646899-173646921 CCATTGCCCTGGGGGAAGATAGG - Intergenic
1002045428 5:176538875-176538897 CAATTGTCCTTAGGGAGAACTGG + Intergenic
1005195964 6:23284311-23284333 CTTTTGTCCTTGTGTAATATTGG + Intergenic
1005949155 6:30618368-30618390 GGAATGTCCTTGGGGAAATTAGG + Intronic
1006283570 6:33076376-33076398 TCAGTGTCTTTGGGGAAAATGGG + Intronic
1007772532 6:44202848-44202870 CTATTGTCTCTGGGAACAATGGG - Intergenic
1010760390 6:79715947-79715969 CTTTTGTCATTCAGGAAAATAGG - Intergenic
1011628096 6:89299593-89299615 CTTTTCTCCTTGGGAAAATTAGG + Intronic
1012544346 6:100400482-100400504 AAATAATCCTTGGGGAAAATAGG + Intronic
1013810679 6:114041298-114041320 TTATAGTCATTGGGGGAAATAGG + Intergenic
1017369337 6:153686675-153686697 CTATTGTCTTTGAGGAACTTGGG + Intergenic
1024057897 7:45677336-45677358 CTATTTTCCTTTTGGCAAATGGG + Intronic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024702472 7:51919478-51919500 TTATTTTACTAGGGGAAAATGGG + Intergenic
1025035858 7:55592160-55592182 CTACTGCCCTTGAGGACAATGGG - Intergenic
1027482763 7:78719052-78719074 CTTATGTCTGTGGGGAAAATAGG + Intronic
1027793566 7:82662321-82662343 CTATGTTCCTGGGGGGAAATGGG + Intergenic
1028689723 7:93637977-93637999 AAATAGTCCTTGTGGAAAATGGG + Intronic
1030160195 7:106499838-106499860 CTATGGGCCTTGGGGGAAATTGG - Intergenic
1030399280 7:109028267-109028289 CTTTCTTCTTTGGGGAAAATTGG + Intergenic
1032273770 7:130436592-130436614 ATATAATCATTGGGGAAAATGGG + Intronic
1032554484 7:132817445-132817467 CTATTCTCCTTAGGGACAAAAGG + Intronic
1034771320 7:153780635-153780657 GGATTGGCCCTGGGGAAAATAGG + Intergenic
1035826468 8:2649469-2649491 ATATGGTCCTTGTGGAAAACTGG + Intergenic
1037209496 8:16368969-16368991 TTATTGTGCTGGGAGAAAATTGG - Intronic
1039018045 8:33174738-33174760 TTATTGTCATTGGGGAAGCTAGG + Intergenic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053409966 9:37909557-37909579 CTCTTGTCCTTGGGGCAGAAGGG + Intronic
1053570483 9:39299992-39300014 TTATTGTTATTGTGGAAAATGGG - Intergenic
1053836433 9:42140919-42140941 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054092105 9:60859001-60859023 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054113518 9:61134591-61134613 TTATTGTTATTGTGGAAAATGGG - Intergenic
1054126664 9:61319020-61319042 TTATTGTTATTGTGGAAAATGGG + Intergenic
1054594179 9:67047582-67047604 TTATTGTTATTGTGGAAAATGGG + Intergenic
1055807572 9:80114056-80114078 TTATTGTCATTGTTGAAAATTGG + Intergenic
1055870720 9:80876060-80876082 CTATTGTACTTGGAGAAAAAGGG - Intergenic
1056097088 9:83266460-83266482 TTATGGTCCTTGAGGGAAATAGG - Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185654561 X:1673678-1673700 CTTTTGTCCTTGGAAAACATTGG - Intergenic
1186601259 X:11040242-11040264 CTATTAACTTTAGGGAAAATAGG + Intergenic
1187041711 X:15603422-15603444 GTATTGTCTTTGAGAAAAATTGG + Intergenic
1187049591 X:15682689-15682711 ATATTCTCCTTGGGGAAAACAGG - Intergenic
1187079040 X:15966703-15966725 CGATTGTCTTTGGCAAAAATGGG - Intergenic
1190777838 X:53568261-53568283 CTATTGTGTTGGGGGAAATTTGG - Intronic
1192964805 X:76165964-76165986 CTACTATCCCTGGGGAAACTGGG - Intergenic
1193188046 X:78536974-78536996 CAATTGTCTTTGAGAAAAATTGG + Intergenic
1195095779 X:101499798-101499820 ATAATGTCCTGGGGGGAAATAGG + Intronic
1196286423 X:113886178-113886200 CTATTTTACTTTGGGTAAATGGG - Intergenic
1197287150 X:124609173-124609195 CTATGGCCCTTAGGGGAAATGGG - Intronic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1197964372 X:132042138-132042160 CTATTGACAATGGGGACAATGGG + Intergenic
1198590333 X:138173433-138173455 CCCTGCTCCTTGGGGAAAATTGG + Intergenic
1200375732 X:155777913-155777935 CTATTGTGATTAGGGAAGATGGG - Exonic