ID: 1176910938

View in Genome Browser
Species Human (GRCh38)
Location 21:14564525-14564547
Sequence CAGTGGTGTCAGACAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 597}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176910938_1176910945 30 Left 1176910938 21:14564525-14564547 CCCAGGCCTGTCTGACACCACTG 0: 1
1: 0
2: 5
3: 64
4: 597
Right 1176910945 21:14564578-14564600 AAAACTCACAAGATAATTAGTGG 0: 1
1: 0
2: 2
3: 41
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176910938 Original CRISPR CAGTGGTGTCAGACAGGCCT GGG (reversed) Intronic
900589088 1:3451792-3451814 CTTTGGCGTCAGACAGACCTGGG + Intergenic
901309767 1:8260144-8260166 CAGTGGTTTGAGACCAGCCTGGG - Intergenic
901647235 1:10723255-10723277 CAGTGGTGATGGACAGGCCAGGG - Intronic
902202875 1:14846911-14846933 CTGTGGTGTCAGCCAGACCCGGG - Intronic
902220274 1:14960175-14960197 CTGTGGAGTCAGCCAGGCCTTGG + Intronic
902411617 1:16215200-16215222 TGGTGGGGTCAGACAGACCTGGG - Intergenic
902441481 1:16433010-16433032 CATGGGAGTCAGACAGGCCTGGG - Intronic
902632754 1:17715406-17715428 CAGAGGTGTCTGATAGGCCTGGG - Intergenic
902633673 1:17720722-17720744 CCCTGGTGTCAGACAGACTTGGG + Intergenic
902776895 1:18680597-18680619 CAGTGAGGTCAGACGGACCTGGG - Intronic
902839380 1:19065599-19065621 CTTTGGTGTCAGACAGTCCTGGG - Intergenic
903178953 1:21595970-21595992 CTGTGCTGTCAGGCAGACCTAGG - Intergenic
903461995 1:23526718-23526740 CTTTGCAGTCAGACAGGCCTGGG - Intronic
903993636 1:27290851-27290873 CAGTGAAGTCAGACAGACCTGGG + Intronic
904081348 1:27874241-27874263 CAGGGGTTTGAGACCGGCCTGGG - Intronic
904283609 1:29438869-29438891 CAGAGGAGTCAGAAAGACCTGGG - Intergenic
904615801 1:31748959-31748981 CTCTGGAGTCAGGCAGGCCTGGG - Intronic
905035925 1:34918391-34918413 ATGTGGTCTCAGCCAGGCCTTGG + Intronic
905234343 1:36535686-36535708 CAGGGGTGTGAGACCAGCCTGGG - Intergenic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905858713 1:41331696-41331718 GATTGGGGTCAGACAGACCTGGG + Intergenic
906131890 1:43465013-43465035 CAGTGGTTTGAGACTAGCCTGGG - Intergenic
906258775 1:44370292-44370314 CCTTGGAGTCAGACAGTCCTGGG + Intergenic
906279651 1:44544314-44544336 CTCTGGAGTCAGACAGACCTGGG + Intronic
906694113 1:47812510-47812532 CAGAAGTTTGAGACAGGCCTGGG + Intronic
907170940 1:52463995-52464017 CTCTGGAGTCAGACAGACCTGGG + Intronic
907246867 1:53114324-53114346 CCTTGGAGTCAGACAGGACTAGG + Intronic
907340445 1:53731542-53731564 CTCTGCTGTCAGACAGACCTGGG + Intronic
907366286 1:53963424-53963446 CTGTGGAGTCAGAAAGACCTGGG + Intronic
907575371 1:55521411-55521433 CACAGGCATCAGACAGGCCTGGG + Intergenic
907651198 1:56296352-56296374 GAGTGGAGTCAGACACACCTGGG + Intergenic
908251099 1:62266628-62266650 CAGTGGTGTGAGGCAGGCAGTGG - Intronic
909494404 1:76262302-76262324 CACTGGTGTCAGGCAGAGCTGGG - Intronic
910516922 1:88072393-88072415 CTCTGGAGTCAGACAGACCTGGG + Intergenic
911985854 1:104620948-104620970 CAGGGGTTTGAGACAAGCCTGGG + Intergenic
912694782 1:111833018-111833040 CAGTGTTGCCAAACTGGCCTTGG + Intronic
913247700 1:116884694-116884716 CAGTGGTGCCAGGCAGGCAGTGG + Intergenic
914076593 1:144358068-144358090 CAGTGGTGTCAGACACTCTGAGG + Intergenic
914102585 1:144608429-144608451 CAGTGGTGTCAGACACTCTGAGG - Intergenic
915033516 1:152903890-152903912 CTTTGCTGTCAGACAGGCCTGGG - Intergenic
915076394 1:153311453-153311475 CTCTGGAGTCAGACAGACCTGGG - Intergenic
915500905 1:156316651-156316673 CAGGAGTTTGAGACAGGCCTAGG + Intronic
915728440 1:158035664-158035686 ATTTGGGGTCAGACAGGCCTGGG - Intronic
915945197 1:160144986-160145008 CCCTGGAGTCAGACTGGCCTAGG - Intergenic
915959663 1:160254855-160254877 CTTTGGTGTCAAACAGACCTGGG + Intronic
917302279 1:173588862-173588884 CAGTAGTGTAAGACCAGCCTGGG + Intronic
918220273 1:182430404-182430426 CAGGGGTTTCAGACAAGCCTGGG - Intergenic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
920101570 1:203520185-203520207 GAGTGGGGTCAGAAATGCCTGGG + Intergenic
920740917 1:208580469-208580491 CTTTGGAGTCAAACAGGCCTGGG + Intergenic
920880777 1:209878483-209878505 CAGAGGTGTTTGACAAGCCTTGG - Intergenic
920930434 1:210382905-210382927 CCTTGGCTTCAGACAGGCCTAGG + Intronic
922515747 1:226207069-226207091 CTGTGGTATCAGGCAGACCTGGG + Intergenic
923272356 1:232369312-232369334 CAGTTGTGTCAGACCAGCCTAGG + Intergenic
924035817 1:239935673-239935695 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
924568762 1:245219522-245219544 CAGGGGTTTCAGACTAGCCTGGG + Intronic
924758001 1:246959075-246959097 CAGGAGTTTCAGACAAGCCTGGG + Intronic
924905205 1:248444783-248444805 CAGTGGACAAAGACAGGCCTGGG + Intergenic
1062817396 10:510526-510548 CAGCCGTGCCAGGCAGGCCTGGG + Intronic
1064155625 10:12901040-12901062 CCCTGGTGTCAGCCAGTCCTTGG - Intronic
1064225083 10:13475810-13475832 CTTTGGAGTCAGACAGGCCTTGG + Intronic
1065978449 10:30865010-30865032 CTTTGGTGCCAGACAGTCCTGGG - Intronic
1067569018 10:47358308-47358330 CAGTGATGTCAGCCTTGCCTGGG + Intergenic
1067784039 10:49229588-49229610 CAGTGGAGTCACACAGGCCGGGG + Intergenic
1070128286 10:73639328-73639350 CAGGGGTTTGAGACTGGCCTAGG - Intronic
1070752675 10:78973481-78973503 CTGTGGTCAAAGACAGGCCTGGG + Intergenic
1070761089 10:79024853-79024875 CAGAGGTGTCAGCAAGGCCCAGG + Intergenic
1070779481 10:79129381-79129403 CAGTGGACTCAGGCAGGCCTTGG - Intronic
1071366946 10:84909191-84909213 CTCTGGCGTCAGACAGCCCTGGG - Intergenic
1072230030 10:93406902-93406924 TAGTGTGGTAAGACAGGCCTGGG + Intronic
1072255481 10:93616390-93616412 CTGTGGCATCAGACAGACCTGGG + Intronic
1072498513 10:95987861-95987883 CAGTGGAGGCAGACAGTCCTAGG - Intronic
1072537885 10:96377099-96377121 CAGTGGGGTCAGGTGGGCCTCGG + Intronic
1073460750 10:103664505-103664527 CAGTGGTGTCAGGTGGGCTTGGG - Intronic
1073467073 10:103700515-103700537 CCATGATGACAGACAGGCCTGGG + Intronic
1074374175 10:112925434-112925456 CAGAAGTTTCAGACAAGCCTGGG + Intergenic
1074460500 10:113632531-113632553 CTTTGGTGTCAGAGAGACCTAGG - Intronic
1074942271 10:118247162-118247184 CAGTGTTGTCAGACGGGCACTGG + Intergenic
1075198165 10:120378959-120378981 CAGTGGTGGCTGGCAAGCCTTGG + Intergenic
1075551094 10:123392750-123392772 CAGTGCTGTCAGCCAGCCCTGGG - Intergenic
1075635539 10:124027830-124027852 CTTTGGGGTCAGGCAGGCCTGGG - Intronic
1076066334 10:127451122-127451144 CAGAGGCGTCAGAAAGGCCCAGG + Intronic
1076251237 10:128985224-128985246 CAGAGGTGTCAGCCAGCCCTAGG + Intergenic
1076534493 10:131168071-131168093 CAGTGCAGTCAGGGAGGCCTGGG + Intronic
1076788340 10:132762780-132762802 CAGTAGTCTCAGACAAGCCAGGG + Intronic
1076833262 10:133007467-133007489 CAGTGGTGACAGCCAGTCCCTGG + Intergenic
1077191074 11:1256122-1256144 GAGAGGTGTCAGACAAGCCAAGG - Intronic
1078123702 11:8537296-8537318 CAGGGGTTTCAGACCAGCCTAGG - Intronic
1078286744 11:9964040-9964062 CAGAGGTTTGAGACAAGCCTGGG + Intronic
1078428362 11:11269065-11269087 CTGTAGTCTCAGACAGGCCCTGG - Intergenic
1078438083 11:11341911-11341933 CAGGAGTGTGAGACAAGCCTGGG + Intronic
1079203165 11:18392614-18392636 CAGTGTTCTCAGTCAGGGCTGGG - Intergenic
1079204205 11:18399801-18399823 CAGTGGTTCAAGACAGGCCTGGG - Intronic
1079534744 11:21499836-21499858 GACTGGTGTTAGACAGCCCTGGG - Intronic
1080128609 11:28766873-28766895 CAGTGATTACCGACAGGCCTAGG - Intergenic
1080217729 11:29864847-29864869 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1080847178 11:36036619-36036641 CTCTGGTGTCAGGCAGCCCTGGG - Intronic
1081318884 11:41666191-41666213 CAGTGCAGTCACACAGGGCTCGG + Intergenic
1081447490 11:43144944-43144966 AGGTGGTGACAGACAGGCGTGGG - Intergenic
1082140565 11:48603678-48603700 CGGTGGTGCCAGACAGGAATGGG + Intergenic
1082567758 11:54700778-54700800 CTGTGGTGCCAGACAGGAATGGG + Intergenic
1082809806 11:57472855-57472877 CTCTGGAGTCAGACAGACCTGGG - Intronic
1083324976 11:61868713-61868735 CTCTGGGGTCAGACAGACCTAGG - Intergenic
1083481246 11:62949059-62949081 GAGGGGTGTCACACAGGTCTCGG + Intronic
1083551171 11:63591171-63591193 CAGGAGTTTCAGACAAGCCTGGG + Intronic
1083611583 11:64006966-64006988 CAGGGGTGGCAGGAAGGCCTGGG + Intronic
1083897584 11:65627826-65627848 TCGTGGGGTCAGACAGGCCTGGG - Intronic
1084073162 11:66750911-66750933 CAGGGGTTTCAGACCAGCCTGGG - Intronic
1084722288 11:70914607-70914629 CAGGAGTGTAAGACCGGCCTGGG + Intronic
1085073495 11:73570531-73570553 CAGGAGTGTGAGACAAGCCTGGG + Intronic
1085451810 11:76638741-76638763 AAGTGGGGGCAGACAAGCCTGGG - Intergenic
1085752293 11:79172160-79172182 CAGGGGTTTCAGACCAGCCTGGG - Intronic
1085764751 11:79273054-79273076 CTTTGGAGTCAGTCAGGCCTTGG + Intronic
1085802585 11:79604274-79604296 CTGTGGTGTCTGATTGGCCTTGG + Intergenic
1085812260 11:79694713-79694735 CACTGGTACCAGATAGGCCTTGG - Intergenic
1087183137 11:95158964-95158986 CTGTGGAGTCAGACACACCTAGG - Intergenic
1087192108 11:95265848-95265870 CAGTGGTTTGAGACCAGCCTGGG + Intergenic
1087822082 11:102723846-102723868 CTTTGGAATCAGACAGGCCTGGG + Intronic
1089009900 11:115123732-115123754 CTTTGGAGTCAGGCAGGCCTGGG - Intergenic
1089405571 11:118194670-118194692 CTGTGGAGTTAGACAGACCTGGG - Intronic
1089418454 11:118313497-118313519 CACTGGAGTCAAACAGCCCTGGG - Intronic
1089593255 11:119558668-119558690 TAGTGGGGTCAGACAGACCCAGG + Intergenic
1090358992 11:126159904-126159926 CAGTGGTGGCAGATAGGCCCTGG - Intergenic
1090757232 11:129803368-129803390 CTGTGGTGTCAGGCAGGAATGGG - Intergenic
1091403382 12:194453-194475 CAGTGGAGTCAGAGGGACCTGGG + Intronic
1091404045 12:197933-197955 CAGGGGTGCCTGACAGCCCTGGG - Exonic
1091669252 12:2440648-2440670 CAGGGGTTTCAGACAGTCCATGG + Intronic
1092877345 12:12859836-12859858 CAGGAGTTCCAGACAGGCCTGGG - Intergenic
1093247170 12:16754040-16754062 CTCTGGAGTCAGACAGCCCTGGG - Intergenic
1093725496 12:22503718-22503740 CAGGGGTTTGAGACCGGCCTGGG - Intronic
1093956547 12:25226989-25227011 CTGTGGAGTCAAACAGGCCTAGG + Intronic
1094043802 12:26145492-26145514 CAGTGGTGTCCGCTATGCCTGGG + Intronic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1097322422 12:58241015-58241037 CAGTGGTTTGAGACCAGCCTGGG + Intergenic
1097904875 12:64909437-64909459 CAGTGGTGCCAGAAAGACTTGGG - Intergenic
1098111271 12:67124168-67124190 CAGTGGTTTGAGACCAGCCTGGG + Intergenic
1099254130 12:80294876-80294898 CAGTAGTTTGAGACCGGCCTGGG + Intronic
1099275234 12:80566746-80566768 CAGTGGTTTGAGACCAGCCTAGG - Intronic
1099777504 12:87151789-87151811 CTGTGGTGTCAGGCAGGAATGGG + Intergenic
1100291083 12:93215360-93215382 CTGTGGTGTCAGGCAGGAATGGG + Intergenic
1100350393 12:93775631-93775653 GACAGGTGTCAGACAAGCCTGGG - Intronic
1100389856 12:94139051-94139073 CAGTGATCCCAGTCAGGCCTAGG - Intergenic
1100578310 12:95913839-95913861 CTTTGGAATCAGACAGGCCTTGG + Intronic
1101532179 12:105583414-105583436 CAGAGGAGTCAGGCAGACCTGGG - Intergenic
1101615627 12:106334177-106334199 AAGTGGTGTCAGAAAAGCCAGGG + Intronic
1101654706 12:106709683-106709705 CTTTGGTGTCAGACAGACCTGGG - Intronic
1101820916 12:108183790-108183812 GTCTGGAGTCAGACAGGCCTGGG + Intronic
1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG + Intergenic
1102016335 12:109650387-109650409 CAGTAGTTTCAGACAAGCCTGGG + Intergenic
1102804627 12:115768892-115768914 CATTGGAGTCAGACAGATCTGGG - Intergenic
1102916832 12:116760457-116760479 CCGTGGTGCCAGACAGGAATGGG + Intronic
1103455149 12:121059637-121059659 CAGGGGTGTCATACAGGTCCTGG + Intergenic
1103727357 12:123004752-123004774 ACGTGGGGTAAGACAGGCCTGGG + Intronic
1103783654 12:123416114-123416136 CAGGAGTCTCAGACATGCCTGGG + Intronic
1104216665 12:126740578-126740600 CAGTGGGCTCATGCAGGCCTGGG + Intergenic
1104571034 12:129926264-129926286 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1104662566 12:130621600-130621622 CCGTGGGCTCAGAGAGGCCTTGG - Intronic
1105550499 13:21390689-21390711 CAGGAGTTTGAGACAGGCCTGGG + Intronic
1106283341 13:28297011-28297033 CAGAGTTTTGAGACAGGCCTGGG + Intergenic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1106511786 13:30419377-30419399 CTGTGGTGGCAGACAGGCCTGGG + Intergenic
1107367814 13:39703940-39703962 CAGTAGTTTGAGACAAGCCTGGG - Intronic
1107873974 13:44772791-44772813 CAGTGGTTTGAGACCAGCCTGGG - Intergenic
1108242495 13:48480393-48480415 CAAAGTAGTCAGACAGGCCTGGG - Exonic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1108897932 13:55358713-55358735 CAGGGGTGTGAGACTAGCCTGGG - Intergenic
1109511315 13:63378567-63378589 CAGGTGTTTGAGACAGGCCTAGG - Intergenic
1110603511 13:77403795-77403817 CAGAGGTGACAGATAGGCCCAGG + Intergenic
1110706462 13:78605487-78605509 CAGGGGTGTCAGGAAGGACTAGG - Intergenic
1110927471 13:81173072-81173094 CTTTGGAGTCAGAGAGGCCTGGG + Intergenic
1112035465 13:95492786-95492808 CTGTGGTGTCAGGCAGGAATGGG + Intronic
1112656932 13:101461483-101461505 CAGTGGTTTGAGACCGGCCTGGG + Intronic
1113467205 13:110520693-110520715 CAGTGGTGTCAGGGAGTCCTGGG - Intergenic
1114287275 14:21256860-21256882 CAGGGGTTTGAGACCGGCCTGGG - Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1116963410 14:50990224-50990246 CAGTGGTTTGAGACCAGCCTGGG - Intronic
1117360825 14:54971976-54971998 CAGTAGTTTCAGACCAGCCTGGG + Intronic
1117709224 14:58506936-58506958 CAGGGGTTTCAGACCAGCCTTGG + Intronic
1118648719 14:67867389-67867411 CAGTGATGACAGAGAGACCTAGG + Intronic
1118683739 14:68269888-68269910 CAGTAGTGGAACACAGGCCTTGG + Intronic
1118839111 14:69497781-69497803 CAGTGGGGGCAGAAAGGCCTAGG + Intronic
1119180099 14:72599844-72599866 CTGTGGGCTCACACAGGCCTCGG + Intergenic
1122072039 14:99211205-99211227 ACGGGGTGCCAGACAGGCCTGGG - Intronic
1122536341 14:102466164-102466186 CAGTGGTGTCCACCAGCCCTGGG + Intronic
1122631104 14:103108127-103108149 CAGTGCTTTCAGGCTGGCCTCGG + Intronic
1122690220 14:103528753-103528775 CAGCAGTGACAGCCAGGCCTTGG + Intergenic
1122776317 14:104118403-104118425 GAGATGGGTCAGACAGGCCTGGG + Intergenic
1123626435 15:22229944-22229966 CTTTGGAATCAGACAGGCCTGGG - Intergenic
1124353509 15:28977932-28977954 CTGTGGACTCAGGCAGGCCTCGG + Intronic
1124707003 15:31974581-31974603 CAGTGGTCTGGGGCAGGCCTTGG - Intergenic
1125590199 15:40849683-40849705 CTGTGGAGTCTGACAGACCTTGG + Intronic
1126075626 15:44906410-44906432 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
1126509602 15:49454064-49454086 AAGATGTGTCAGACAGGCGTAGG + Intronic
1127149947 15:56063190-56063212 CAGGGGTGTGAGACAAGCCTGGG + Intergenic
1127661754 15:61106029-61106051 CACTGGTGTCAGGCAGACCCTGG + Intronic
1128524475 15:68403058-68403080 CAGGGGAGTCAGACAGGCAGAGG + Intronic
1128755324 15:70179811-70179833 CTGTGGTGTCAGCCAATCCTAGG + Intergenic
1129365963 15:75054962-75054984 CAGAAGTTTGAGACAGGCCTAGG + Intronic
1130059433 15:80559070-80559092 CATTGGAGGGAGACAGGCCTGGG - Intronic
1130563142 15:84974372-84974394 CTTTGGTGTCAGGCAGGCCACGG + Intergenic
1130575569 15:85090162-85090184 CTTTGGTGTCAGACGGGCCTGGG + Intronic
1131131481 15:89903461-89903483 CAGTGGTTTAACCCAGGCCTAGG - Intronic
1131363657 15:91818367-91818389 CTGGGGTGTCAGAAGGGCCTGGG + Intergenic
1131397615 15:92098963-92098985 CTTTGAGGTCAGACAGGCCTGGG - Intronic
1132386535 15:101404581-101404603 GAGTGGGGTCAGAGAGTCCTGGG + Intronic
1133377012 16:5295468-5295490 CCGTAGTGTCAGCCAGGGCTCGG + Intergenic
1133738030 16:8630446-8630468 CTGTGGCGTCAGACAGACCTAGG - Intronic
1134175363 16:12001807-12001829 CAGGGGTGTGAGACCAGCCTGGG + Intronic
1134293557 16:12923909-12923931 CTGTGGAGTCGGACAGACCTGGG - Intronic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134654530 16:15938105-15938127 CAGTGGTTTGAGACCAGCCTGGG + Intergenic
1135029820 16:19029581-19029603 CAGGAGTTTCAGACAAGCCTGGG - Intronic
1135078742 16:19415970-19415992 CAGTAGTTTGAGACAAGCCTGGG + Intronic
1135709034 16:24699507-24699529 CAGGAGTGCCAGACAAGCCTGGG + Intergenic
1135868768 16:26129385-26129407 CTATGGTGTCAGACAGACTTGGG + Intronic
1136147131 16:28322240-28322262 CTGTGGTGCAAGGCAGGCCTGGG - Exonic
1136177056 16:28524343-28524365 CAGGAGTGTGAGACCGGCCTGGG + Intergenic
1136295078 16:29296985-29297007 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1136687772 16:32005226-32005248 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136788375 16:32948777-32948799 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136881440 16:33905154-33905176 CTCTGGAGTCAGACAGTCCTGGG - Intergenic
1137243251 16:46677742-46677764 CAGGAGTTTGAGACAGGCCTGGG - Intronic
1137347088 16:47673939-47673961 CACTGGAGTCAGGCAGACCTGGG - Intronic
1138102578 16:54265596-54265618 CAATGGTGTCAGGCAGAACTGGG + Intronic
1138341861 16:56295258-56295280 CTCTGGGGTCAGACAGTCCTGGG + Intronic
1139777104 16:69323356-69323378 CAGCAGTTTCAGACTGGCCTGGG - Intronic
1140169872 16:72593504-72593526 CTGAGGTTTCAGACCGGCCTGGG + Intergenic
1141505963 16:84478888-84478910 CAGTGGTGAGTGACTGGCCTGGG - Exonic
1141582269 16:85007912-85007934 CAGGGGTTTCAGACCAGCCTGGG + Intronic
1141765426 16:86055240-86055262 CAGTGGAATCAGTCAGTCCTGGG - Intergenic
1141977541 16:87527440-87527462 CTTTGGAATCAGACAGGCCTGGG + Intergenic
1142100979 16:88270994-88271016 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1142144228 16:88486120-88486142 CAGTGGTGTCTGAGAGGTGTGGG + Intronic
1142428975 16:90016301-90016323 AGAGGGTGTCAGACAGGCCTGGG - Intronic
1203090574 16_KI270728v1_random:1210292-1210314 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1142769526 17:2086601-2086623 CAGTGCTGTCAGAGAAGCTTGGG + Intronic
1143076103 17:4344636-4344658 CAGAGGTTTGAGACCGGCCTGGG + Intronic
1143427809 17:6854004-6854026 CAGTGGTGCCAGGCAGGAATAGG - Intergenic
1144808684 17:17984738-17984760 CTGTGAGGTCAGACAGGCGTGGG - Intronic
1145247372 17:21278336-21278358 GAGTTGTCTCAGCCAGGCCTTGG - Intergenic
1146404757 17:32527582-32527604 CAGGAGTTTCAGACCGGCCTGGG + Intronic
1146909841 17:36641616-36641638 CAGTGGGGGCAGACGGGCCTGGG - Intergenic
1147559001 17:41497557-41497579 CAGCGGTGTGAGACTGGCATGGG + Intergenic
1147627452 17:41909282-41909304 CAGAGGTGTCAGACAGACAGGGG + Intronic
1147632278 17:41939816-41939838 CTGTGGAGTCAGGCAGACCTAGG + Intronic
1148332525 17:46820877-46820899 CAGTGGTGTCTGAGTGGCCAGGG - Intronic
1148850565 17:50552760-50552782 CAGTAGTTTCAGACCAGCCTGGG - Intronic
1149246727 17:54717369-54717391 CAGAAGTTTCAGACCGGCCTGGG - Intergenic
1149690096 17:58568268-58568290 CAGTGCTGTCAGACCTTCCTTGG - Intronic
1150207161 17:63417771-63417793 AGGGGGTGTCAGACAGACCTGGG - Intronic
1150495875 17:65607422-65607444 CAGTCGTGTCTGCCAGCCCTTGG - Intronic
1150604352 17:66678214-66678236 CAGTGGTGGCAGGCATGACTTGG - Intronic
1151036914 17:70811141-70811163 CAGGAGTTTGAGACAGGCCTAGG - Intergenic
1151363014 17:73599891-73599913 CTGTGTTGGCAGACAGGACTTGG - Intronic
1151486269 17:74402888-74402910 CAGTAGTCTGAGACCGGCCTGGG + Intergenic
1151698754 17:75731458-75731480 CCCTGGAGTCAGGCAGGCCTGGG + Intronic
1151862421 17:76774558-76774580 AAGGGGAGTCAGAGAGGCCTAGG - Intronic
1151892663 17:76959829-76959851 CCATGGAGTCAGACAGCCCTGGG + Intergenic
1151900857 17:77013219-77013241 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
1151981187 17:77510230-77510252 GAGGGGTGCCAGCCAGGCCTGGG - Intergenic
1151994396 17:77599425-77599447 CAGTGGTGTCAGAGACGCAGTGG + Intergenic
1152033812 17:77859548-77859570 CAGTGGTACCAGTCAGCCCTGGG + Intergenic
1152272067 17:79330610-79330632 CAGGGGTGTGGGAGAGGCCTGGG - Intronic
1152273168 17:79337309-79337331 CAGTGGTGCCAGAGATGCCAAGG - Intronic
1152347346 17:79761150-79761172 CAGAGGTTCAAGACAGGCCTGGG + Intergenic
1152534374 17:80941819-80941841 CAGAGGTGTGAGCCGGGCCTAGG - Intronic
1152742459 17:82024294-82024316 CGGTGTTGGCACACAGGCCTCGG - Exonic
1152941379 17:83174468-83174490 CAGTGGGGGCAGACAGACCTGGG - Intergenic
1153476924 18:5506989-5507011 CACTGATGTCAGACAGACATGGG + Intronic
1153775638 18:8451086-8451108 CAGGGGTATCTGAGAGGCCTTGG + Intergenic
1153914341 18:9732546-9732568 CTCTGGTGTCAGACAAGCCTGGG - Intronic
1154003015 18:10500925-10500947 CAGGAGTCTCAGACTGGCCTGGG - Intergenic
1155247200 18:23921930-23921952 CAGGGATGTCTGTCAGGCCTTGG - Intronic
1155574948 18:27234441-27234463 CAGAGGTTTCAGACCAGCCTAGG - Intergenic
1155952415 18:31927837-31927859 CAGTGGTTTGAGACCAGCCTAGG + Intronic
1156799447 18:41091102-41091124 GAGTAGAGTCAAACAGGCCTGGG - Intergenic
1156812011 18:41263965-41263987 ATGTGGTGTCACAGAGGCCTTGG + Intergenic
1158692275 18:59671291-59671313 CAGGGGTGTGAGACCAGCCTGGG + Intronic
1159699649 18:71609064-71609086 TAGGGGTGTCAGACAGGCTTGGG - Intergenic
1160122636 18:76144589-76144611 CACTGGAGTCAGACAGAGCTCGG - Intergenic
1160709016 19:542251-542273 GACTTGGGTCAGACAGGCCTGGG + Intergenic
1161601831 19:5188906-5188928 CAGGGGTTTGAGACTGGCCTAGG + Intronic
1161653011 19:5496741-5496763 CTCTGGTAACAGACAGGCCTAGG - Intergenic
1161968188 19:7560782-7560804 CAGTGGAGTCAGAGTGGCCCTGG - Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162031612 19:7919976-7919998 CTCTGGGGTCAGACAGGCCTGGG - Intergenic
1162147926 19:8624641-8624663 CAGAGGTTTGAGACCGGCCTGGG + Intergenic
1162157221 19:8686695-8686717 CATTGGAGTCAGACAGGCCTGGG - Intergenic
1162802852 19:13120457-13120479 AAGTGGTGTCAGCCAGTTCTGGG + Intronic
1162861478 19:13508504-13508526 CAGGGGTTTGAGACAAGCCTGGG + Intronic
1163236899 19:16035207-16035229 CTGTGGCCTCAGCCAGGCCTTGG - Intergenic
1163655524 19:18543174-18543196 TGGTGGCGTCAGACAGGCGTGGG - Intronic
1163697786 19:18772682-18772704 CAGTGGTCCCAGACGGCCCTTGG - Intronic
1164566064 19:29326951-29326973 CAGGTGTTCCAGACAGGCCTAGG - Intergenic
1165043467 19:33085412-33085434 CAGTGGTTTGAGACAAACCTGGG - Intronic
1165189008 19:34046730-34046752 CAGTAGTTTGAGACTGGCCTGGG + Intergenic
1166074953 19:40408564-40408586 CTCTGCTGCCAGACAGGCCTCGG - Intronic
1166213102 19:41319898-41319920 AAGTGGAGACAGACAGGCCTAGG - Intronic
1166225297 19:41391415-41391437 CTCTGGAGTCAGACTGGCCTGGG + Intronic
1167601480 19:50457525-50457547 TGCTGGAGTCAGACAGGCCTGGG + Intronic
1167802353 19:51752596-51752618 CAGGGGTCTGAGACATGCCTGGG - Intronic
1168540795 19:57208061-57208083 CAGGGGTTTCAGACCAGCCTGGG - Intronic
925346046 2:3172711-3172733 ATCTGGAGTCAGACAGGCCTGGG - Intergenic
925542329 2:4979321-4979343 CAGTGGCCTCTGCCAGGCCTGGG - Intergenic
925670954 2:6309377-6309399 CAGTGTTGTCACCCGGGCCTTGG + Intergenic
925675319 2:6356124-6356146 CAGTGGTGTCTGATAGCCCTGGG + Intergenic
925865884 2:8225438-8225460 ACGTGGTGTGAGCCAGGCCTGGG - Intergenic
927864330 2:26579070-26579092 CACAGATGTCAGACAGACCTGGG - Intronic
927978525 2:27358451-27358473 CAGTAGTGTGAGACCTGCCTGGG - Intergenic
928065253 2:28157932-28157954 CTGTGGGGTCAGGCAGGCCTGGG + Intronic
928283012 2:29965268-29965290 CACTGGAGTCAGACGGACCTGGG - Intergenic
929522166 2:42663550-42663572 CAGGAGTCTGAGACAGGCCTAGG + Intronic
929552719 2:42904607-42904629 CCTTGGAGTCAGTCAGGCCTAGG + Intergenic
929594555 2:43168166-43168188 CCCTGGTGTCAGACAGGACCTGG + Intergenic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
929845144 2:45517784-45517806 CAGAGGTGTCAGACCAGCCTGGG + Intronic
930171011 2:48251774-48251796 CAGGGGTTTGAGACAAGCCTGGG + Intergenic
930840493 2:55839933-55839955 AAGTGATGTCAGCCAGGCTTTGG + Intergenic
931434870 2:62237514-62237536 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
931508069 2:62954164-62954186 ATGTGGAGTCAGACAGACCTGGG - Intronic
931674091 2:64676425-64676447 CTGTGGAGTCAGACAGTCCTGGG + Intronic
932130575 2:69183623-69183645 CAGGAGTGCAAGACAGGCCTGGG - Intronic
932771737 2:74504185-74504207 CCGTGGAGTCAGACCGGCCAGGG + Intergenic
933296962 2:80502041-80502063 CTGTGGAGTCAGAGAGGCCTAGG + Intronic
933693638 2:85198658-85198680 CAGGGGTTTGAGACAAGCCTGGG + Intronic
935182929 2:100706307-100706329 CATTGGTCTAAGAGAGGCCTAGG - Intergenic
935556790 2:104519050-104519072 CAGTGGTTTGAGACCAGCCTGGG - Intergenic
935695351 2:105766529-105766551 CAGGGGTTTCAGACCAGCCTAGG - Intronic
936957759 2:118040512-118040534 CTGTGGTGTGAAACAGGCATGGG - Intergenic
937005716 2:118511073-118511095 CAATAGTGTCAGCCTGGCCTGGG - Intergenic
937044761 2:118845346-118845368 CCGGGGCGTCAGGCAGGCCTTGG + Intronic
937064272 2:119005512-119005534 TATTGGTGCCAGACAGACCTGGG - Intergenic
937315537 2:120929917-120929939 CAGTGGTGTCTGAGACTCCTAGG + Intronic
937374839 2:121329158-121329180 CAGGGGTGTGAGACCAGCCTGGG - Intergenic
937758345 2:125568256-125568278 AAGTGGTGTCAGACAGGCAGCGG + Intergenic
937865866 2:126751548-126751570 CAGTGGTGGCTGAAAGGCCCTGG - Intergenic
938982479 2:136539772-136539794 CTCTGGAGGCAGACAGGCCTGGG - Intergenic
939274122 2:139978099-139978121 CAGGGGTTTGAGACAAGCCTGGG - Intergenic
939494680 2:142914060-142914082 CAGTGGAGCCGCACAGGCCTTGG - Intronic
939683738 2:145171541-145171563 CAGGGGTTTCAGACCAGCCTGGG - Intergenic
939964261 2:148595054-148595076 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
940528561 2:154848786-154848808 CTGTGGTGTCAGACGACCCTGGG - Intronic
940929285 2:159407478-159407500 CTGTGGAGTCAGAAAGTCCTGGG - Intronic
941641491 2:167993594-167993616 CAGTGGTATCAGCCAGGACCTGG - Intronic
941834284 2:169998835-169998857 CTGTGGAGTCAGACAGACTTGGG + Intronic
942053395 2:172161859-172161881 CAGTGGGGTGGGACAGACCTGGG - Intergenic
943506274 2:188763096-188763118 CAGTGGTATCAGCCAAACCTTGG - Intronic
944546410 2:200803490-200803512 CAATGGTGTTTGAAAGGCCTTGG - Intergenic
944631359 2:201628730-201628752 CAGTGGTTGCTGACAGTCCTTGG - Intronic
944686388 2:202121697-202121719 GAGTGAGGACAGACAGGCCTGGG - Intronic
945194264 2:207223717-207223739 GATTGGTGTCACACAGGGCTGGG - Intergenic
946099012 2:217302814-217302836 CTTTGGGGTCAGACAGGCCTGGG + Intronic
946287921 2:218719322-218719344 CAGTGGTGTGAGATAGCCTTGGG + Intronic
948087561 2:235264317-235264339 CTTTGGAGTCAGACAGGACTGGG - Intergenic
948185814 2:236020494-236020516 CTGTGGAGTCACACACGCCTGGG + Intronic
948519392 2:238525868-238525890 CAGAGGTTTCAGACCAGCCTGGG + Intergenic
948723098 2:239913539-239913561 CAGTGGTAGCAGACAGCCCCAGG - Intronic
948894497 2:240921923-240921945 CAGTGGTGGCAGAGTGGCCCTGG + Intronic
949069188 2:242013244-242013266 CGGTGGGGTCGGGCAGGCCTGGG + Intergenic
1169149713 20:3279809-3279831 CTGTGGTGCCAAACAGACCTGGG - Intronic
1169626980 20:7582072-7582094 CAGTAATGTCAGACCTGCCTGGG - Intergenic
1169631068 20:7632489-7632511 CAGGGGTTTGAGACAAGCCTGGG - Intergenic
1169707887 20:8527047-8527069 CAGTGGTGTCAGACACATCTGGG + Intronic
1170208731 20:13826916-13826938 AAGTTGTGTCAGACTGGCCTGGG + Intergenic
1171041280 20:21765871-21765893 CAGTGTTGTCATAGAGGCCCAGG + Intergenic
1171530634 20:25850874-25850896 CACTGGGGTCAGAATGGCCTTGG - Intronic
1172245999 20:33445264-33445286 CACTGGTGTCAAACAGGCCTGGG - Intergenic
1172381289 20:34494748-34494770 CAGGGGTTTGAGACAAGCCTGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172657771 20:36547530-36547552 CTTTGCTGTCAGACAGGCCTGGG - Intronic
1173077979 20:39839143-39839165 TGTTGGTGTCAGATAGGCCTCGG + Intergenic
1173194169 20:40900265-40900287 CAGGGGTTAAAGACAGGCCTTGG + Intergenic
1173430672 20:42984759-42984781 CTTTGGTGTCAGACAAGCCTAGG - Intronic
1173564529 20:44029415-44029437 CTTTGGGGTCAGACAGACCTGGG + Intronic
1173809280 20:45946459-45946481 CTGTAGTGTCAGGCAGGCTTGGG + Intronic
1173862900 20:46295969-46295991 CAGGAGTTTCAGACAAGCCTGGG - Intronic
1173952702 20:47005990-47006012 CACTGGCTTCAGGCAGGCCTGGG + Intronic
1174860472 20:54086502-54086524 CCCTGGAATCAGACAGGCCTGGG + Intergenic
1175406275 20:58732304-58732326 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1175663537 20:60838415-60838437 CAGTGCAGTCGGACAGACCTGGG + Intergenic
1175774814 20:61646448-61646470 CATGGGTGTCAGACACACCTGGG + Intronic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1177744222 21:25191846-25191868 CAGGGGTTTGAGACAAGCCTGGG - Intergenic
1178244033 21:30935307-30935329 CAGTGGGGCCAGACAGGGCCAGG + Intergenic
1178354190 21:31897034-31897056 CAGGGGTTTGAGACAAGCCTGGG + Intronic
1178371703 21:32032193-32032215 CTGTAGTGTCAGACAGGCTGAGG - Intronic
1178557061 21:33601373-33601395 CTTTACTGTCAGACAGGCCTGGG + Intronic
1179491950 21:41746541-41746563 CAGAGGTGACAGACAGGACAGGG - Intronic
1180069917 21:45431139-45431161 CTGGGCTGTCAGGCAGGCCTGGG + Intronic
1180597382 22:16987341-16987363 CAGTGGTGTCAGAGAAGCAGAGG + Intronic
1180944157 22:19680523-19680545 CTGTGGTGTCAGAGAGGCCAAGG + Intergenic
1181762495 22:25067792-25067814 AAGGGGTGTCAGAAAGGCCCTGG + Intronic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182086367 22:27563821-27563843 CTCTGGAGTCAGACAGGTCTGGG + Intergenic
1182161692 22:28128746-28128768 CAGTAGTTTGAGACAAGCCTGGG - Intronic
1182432485 22:30308189-30308211 CTGTAGAGTCAGTCAGGCCTGGG - Intronic
1182471503 22:30551220-30551242 CCTTGGTGTCAGACCTGCCTGGG + Intergenic
1182735476 22:32529727-32529749 AAGGGGTGTCTGTCAGGCCTTGG + Intronic
1182787102 22:32917240-32917262 CATTGGTGTCTGGCAGTCCTGGG - Intronic
1182865596 22:33601515-33601537 TCATGGAGTCAGACAGGCCTGGG + Intronic
1183750121 22:39715239-39715261 CAGGAGTGTGAGACAAGCCTGGG - Intergenic
1184233461 22:43170700-43170722 CAGGAGTTTCAGACAAGCCTGGG + Intronic
1184274936 22:43404822-43404844 CTGAGGCGTCAGACAAGCCTGGG - Intergenic
1184278236 22:43422578-43422600 AAGGGGTGCCAGACAGGCCCTGG - Intronic
1184468512 22:44682819-44682841 TAGTGGGCTCAGAGAGGCCTTGG - Intronic
1184485084 22:44773022-44773044 CAGAGGTTTAAGACTGGCCTGGG - Intronic
1184619622 22:45666381-45666403 CTCTGGAGTCAGACAGACCTGGG - Intergenic
1185074412 22:48675637-48675659 CAGTGGTGTCAGAGCAACCTCGG - Intronic
950050708 3:9986878-9986900 CAGTGGCGTCAGAGCGGCGTCGG + Exonic
950173625 3:10856342-10856364 CAGTGGAGTCAGACAGACCCAGG + Intronic
950187127 3:10952083-10952105 CTCTGGAGTCACACAGGCCTGGG + Intergenic
950206757 3:11086870-11086892 CTTTGGTGTCAGACAGACCTGGG - Intergenic
950397290 3:12743257-12743279 CAGGTGTTTGAGACAGGCCTGGG + Intronic
950570792 3:13798781-13798803 CAGTGGAGGCAGACAGGCCAAGG - Intergenic
950592481 3:13948255-13948277 CTGTGGTGTCAGGCAGGAATGGG + Intronic
952586812 3:34903218-34903240 TTGTGGAGTCACACAGGCCTTGG - Intergenic
952746738 3:36788571-36788593 ATTTGGAGTCAGACAGGCCTGGG + Intergenic
953263390 3:41362102-41362124 CAGTTGTGTCAGACAGCACAGGG + Intronic
953486366 3:43300925-43300947 CTTTGGTGTCAGACAGCCGTGGG + Intronic
953900587 3:46839738-46839760 CAGGAGTTTCAGACAAGCCTGGG + Intergenic
954661361 3:52228681-52228703 AAGTGGGGTCAGTCAGGGCTGGG - Exonic
955281637 3:57599900-57599922 CAGGAGTTCCAGACAGGCCTGGG - Intergenic
955687019 3:61559208-61559230 CTGTGGAGGCAAACAGGCCTGGG + Intergenic
955958470 3:64314748-64314770 CTTTGGTATCAGACAGGCTTTGG + Intronic
956003480 3:64753793-64753815 CAGGGGTTTGAGACAAGCCTGGG - Intergenic
956272177 3:67459750-67459772 CACTGGTGGTAGATAGGCCTGGG + Intronic
956963783 3:74434566-74434588 CTGTGGAGTCAGACAAACCTAGG + Intronic
957501183 3:81058563-81058585 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
958576482 3:95955302-95955324 CATTGAAGTCAGACAGGCTTTGG + Intergenic
959106288 3:102068746-102068768 CGGTGGTCTCAGACACTCCTTGG - Intergenic
959496896 3:107062035-107062057 CTGTGGTGACTGACAGGCCCTGG - Intergenic
960134857 3:114094859-114094881 CAGGAGTGTGAGACAAGCCTGGG + Intergenic
960875571 3:122291962-122291984 CAGGAGTGTGAGACAAGCCTGGG + Intergenic
961019825 3:123496229-123496251 CAGGGGTTCCAGACAAGCCTGGG - Intronic
961616124 3:128182630-128182652 CAGTAGTGTCTGGAAGGCCTTGG + Intronic
962192548 3:133326751-133326773 CCTTGGTGTCAGAAAGTCCTGGG + Intronic
962574187 3:136740687-136740709 CAGGAGTTTCAGACAAGCCTGGG - Intronic
962968397 3:140375398-140375420 CTGTGGTGACTGACATGCCTGGG + Intronic
963264779 3:143229081-143229103 CTTTGGGGTCAGACAGCCCTGGG + Intergenic
963364722 3:144320562-144320584 CAGGGGTTTGAAACAGGCCTGGG + Intergenic
964366075 3:155952026-155952048 CTGTAGAGTCAGACAGGCCTGGG + Intergenic
964809378 3:160646947-160646969 CTCTGGAGTCAGACAGACCTGGG - Intergenic
965146790 3:164914885-164914907 CAGGGGTTTCAGACCAGCCTGGG + Intergenic
965176663 3:165344016-165344038 CAGTGGTTTGACACAAGCCTGGG - Intergenic
966215577 3:177498863-177498885 CAGTGGTAATAGAGAGGCCTTGG - Intergenic
967413133 3:189187194-189187216 CAGTGGTTTGAGACCAGCCTGGG - Intronic
967731728 3:192913185-192913207 CAGGGGTGTGAGACCAGCCTGGG + Intronic
967926354 3:194651883-194651905 CTGTGGAATCAGACAGACCTAGG - Intronic
968170679 3:196507303-196507325 CAGGGGTTTCAGACCAGCCTGGG - Exonic
968558591 4:1263997-1264019 CAGTAGTTTCAGACCAGCCTAGG - Intergenic
968855387 4:3116486-3116508 CAGTGGTCTCTGAGAGGCTTAGG - Intronic
969081030 4:4618222-4618244 CTTTGGAGTTAGACAGGCCTGGG + Intergenic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969315465 4:6379008-6379030 CCTTGGCGTCAGGCAGGCCTCGG - Intronic
969370506 4:6728352-6728374 CAGCGGTGTGTGCCAGGCCTGGG - Intergenic
970179490 4:13375116-13375138 CATTGGTGTCAGAGAGACCTGGG + Intronic
970346670 4:15159214-15159236 CTGTGGTGTCAGGCAGGAATGGG + Intergenic
970537921 4:17048658-17048680 CAGTAGTTTGAGACCGGCCTGGG + Intergenic
970658716 4:18260657-18260679 CTGTGGTGTCAGGCAGGAATGGG + Intergenic
970686289 4:18571367-18571389 CACTATTGTCAGACAGACCTTGG + Intergenic
971172901 4:24251754-24251776 CTGTGGAGTCAGACAGGCCTGGG - Intergenic
973636873 4:52869143-52869165 CAGTGGCATCAGACGGACCTGGG - Intergenic
975517176 4:75259860-75259882 CTGTGGTGTCAGGCAGGAATGGG - Intergenic
975987765 4:80219198-80219220 CAGTGGAGTCAGAAAGACCGTGG + Intergenic
976267037 4:83194466-83194488 CTTTTGTGTCAGATAGGCCTAGG - Intergenic
977558501 4:98508731-98508753 CAGTAGTGTGAGACTAGCCTGGG - Intronic
977773458 4:100888332-100888354 AAGTGCTCTCAGACAGGCATAGG + Intergenic
977803333 4:101265315-101265337 CAGGAGTTTCAGACTGGCCTGGG - Intronic
977916454 4:102599641-102599663 CTTTGGAGTAAGACAGGCCTGGG + Intronic
977924161 4:102681091-102681113 CAGGGGTGTGAGACCAGCCTGGG + Intronic
978726784 4:111978086-111978108 CTGTGGTGTCAGGCAGGAATGGG + Intergenic
979518233 4:121635885-121635907 CATAGGTGTAAGACAGACCTTGG + Intergenic
980638389 4:135539333-135539355 CAGTGGTGTGAGACTAGCCTGGG - Intergenic
981240523 4:142471527-142471549 CAATGGTATCAGAAAAGCCTAGG - Intronic
981684160 4:147434626-147434648 CAAAGCTGTCAGACAGGGCTGGG - Intergenic
982786333 4:159541359-159541381 CAGTGTTGTCAGAAAGATCTAGG + Intergenic
983124558 4:163934348-163934370 CAGTAGTTTCAGACAAACCTGGG + Intronic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
983292010 4:165819136-165819158 AAGTGGTGACAGACAGCACTTGG + Intergenic
983571771 4:169216630-169216652 CAGTGGTTTGAGACCAGCCTAGG + Intronic
984266792 4:177505862-177505884 CTGTGGTGCCAGGCAGGCATGGG + Intergenic
984814361 4:183822921-183822943 CCGTGGAGTCAGGCAGACCTGGG - Intergenic
985710612 5:1426328-1426350 CAGGAGTTTAAGACAGGCCTGGG + Intronic
986044625 5:4025203-4025225 CTGTGGGGCCTGACAGGCCTGGG - Intergenic
988445492 5:31281830-31281852 CTTTGGAGTCAGGCAGGCCTTGG + Intronic
988787765 5:34580104-34580126 CAGGGGTGTGAGACCAGCCTGGG - Intergenic
989171345 5:38472673-38472695 CCGTGGGGACACACAGGCCTGGG + Intergenic
989401806 5:41015804-41015826 CATTTGTGTCAGACAGACCAGGG - Intronic
990350391 5:54909927-54909949 CAGAGATGTCGAACAGGCCTTGG + Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991642679 5:68770420-68770442 GTCTGGAGTCAGACAGGCCTTGG - Intergenic
992430234 5:76703362-76703384 CAGTAGTCTAAGACAAGCCTGGG - Intronic
992478664 5:77128517-77128539 CTCTGGTGTCAGACAAGCCTTGG + Intergenic
993350042 5:86838633-86838655 CAGGGGTTTCAGACTAGCCTGGG - Intergenic
993417473 5:87653022-87653044 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
994937274 5:106271362-106271384 CAGTGGTTGCTGACAGTCCTTGG + Intergenic
995813891 5:116144492-116144514 CTATGGAGTCAGACAGACCTGGG - Intronic
996434653 5:123421508-123421530 CTGGGTTGTCAGACTGGCCTGGG + Intronic
996675268 5:126167959-126167981 CAGTGGTGTTGGACTGGGCTGGG + Intergenic
996727677 5:126686922-126686944 CTCTGGTCTCAGGCAGGCCTAGG - Intergenic
997017905 5:129958738-129958760 CAGGAGTTTCAGACAAGCCTGGG - Intronic
997261688 5:132470291-132470313 AAGTCCTGCCAGACAGGCCTTGG - Intronic
997972879 5:138418420-138418442 CAGTGTTGCCAGAAAGGCCATGG - Intronic
998261080 5:140632368-140632390 CAGGATTGTCAGACAGGTCTAGG + Exonic
999090075 5:148928223-148928245 CTTTGATGCCAGACAGGCCTTGG + Intronic
999132468 5:149294890-149294912 ATGTGGGGTCAGACAGGCCAGGG + Intronic
999310815 5:150550762-150550784 CCATGGTGTCAGAGATGCCTGGG + Intronic
999377495 5:151096991-151097013 CTGTGGAGGCAGGCAGGCCTGGG - Intergenic
1000259993 5:159578623-159578645 CATTTGTATCAGACAGGACTTGG + Intergenic
1000807629 5:165816119-165816141 TAGTGGTTTCACACAGTCCTAGG - Intergenic
1000884610 5:166736815-166736837 TTGAGGTGTCAGACTGGCCTGGG + Intergenic
1001051824 5:168419936-168419958 CTTTGGTGTCAGGCATGCCTGGG + Intronic
1001581253 5:172800095-172800117 CAGTGGAGTGGGACAGGCCAGGG + Intergenic
1001637766 5:173224608-173224630 CAGTAGTTTGAGACCGGCCTGGG + Intergenic
1001753083 5:174146385-174146407 CCCTGGAATCAGACAGGCCTAGG - Intronic
1002143620 5:177161173-177161195 CAGTAGTTTGAGACAAGCCTGGG + Intronic
1002434818 5:179224803-179224825 CTGAGGTGGCAGACAGACCTGGG - Intronic
1003063061 6:2877251-2877273 CTGTGGTGCCAGACAGGAATGGG - Intergenic
1003141634 6:3476512-3476534 CAGTAGTTTGAGACCGGCCTAGG - Intergenic
1003156000 6:3595075-3595097 CTGTGAGGTCAGACAGGCGTGGG - Intergenic
1003322753 6:5066838-5066860 GAGAGGAGTCAGACAGGCCACGG + Intergenic
1003378920 6:5604537-5604559 CTGTGGTTTCAGAGACGCCTGGG - Intronic
1003541620 6:7023579-7023601 CAGGGGTTTGAGACAAGCCTGGG - Intergenic
1003960567 6:11205110-11205132 CATTGGAGTCAGACAGACGTGGG + Intronic
1005783004 6:29212875-29212897 CCATGGTGTCAGACAAGCCTTGG + Intergenic
1006764239 6:36490637-36490659 CAGGAGTTTCAGACTGGCCTGGG + Exonic
1006869656 6:37239844-37239866 CAGGGGTTTCAGACCAGCCTGGG + Intronic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1007094622 6:39205615-39205637 GAGAGGTGTCAGACACCCCTGGG - Intronic
1008515160 6:52311954-52311976 CATTGGTTACAGACAGACCTGGG - Intergenic
1008949214 6:57136942-57136964 CTTTGGTATCAGACAGACCTGGG + Intronic
1009843469 6:69106368-69106390 CGGTGGTGTATGACAGGTCTAGG + Intronic
1011671181 6:89684587-89684609 CTGAGGTGGGAGACAGGCCTGGG + Intronic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1013139922 6:107322633-107322655 CAGGAGTCTGAGACAGGCCTGGG + Intronic
1014089880 6:117391743-117391765 CAGTGGAACCAGACAGGCCCTGG - Intronic
1015553070 6:134432403-134432425 CAGTAGTTTCAGACCAGCCTGGG - Intergenic
1016933547 6:149431625-149431647 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1017354947 6:153493670-153493692 CTGTGGTGTCAGACTGGAGTTGG - Intergenic
1017771547 6:157648681-157648703 CACAGGGGTCAGACATGCCTGGG + Intronic
1018203812 6:161417986-161418008 CCATGGAGTCAGCCAGGCCTGGG - Intronic
1018455159 6:163945141-163945163 CAGTGACATCAGACAGGCCAGGG + Intergenic
1019276207 7:177303-177325 CCGTGATGTCAGCCAGGCCTCGG - Intergenic
1019998758 7:4742623-4742645 CAGGGGTTTCAGACCAGCCTGGG - Intronic
1020121878 7:5508982-5509004 CAGGAGTTTGAGACAGGCCTCGG + Intronic
1020233210 7:6335824-6335846 CAGGGGTGTGAGACCAGCCTGGG + Intronic
1020412008 7:7903012-7903034 AAGTGGTGACAGACAAGACTGGG + Intronic
1021057225 7:16064075-16064097 CAATGGTGTCTGCCAGACCTAGG - Intergenic
1021765174 7:23941729-23941751 CTATGGAGTCAGACAGGTCTGGG + Intergenic
1021948793 7:25754140-25754162 CAGCCGTGTAAGTCAGGCCTTGG - Intergenic
1022189327 7:28001793-28001815 CAGTGGTGGCAGGGAGGACTGGG + Intronic
1022235728 7:28458636-28458658 CTGTGGTTTCAGACAGACCTGGG + Intronic
1022260976 7:28704663-28704685 CAGGTGTTTCAGACAAGCCTGGG - Intronic
1022320437 7:29283121-29283143 CACTGGAGTCAGTCAGTCCTGGG + Intronic
1022371569 7:29776493-29776515 TAGTAGAGTCAGATAGGCCTGGG - Intergenic
1022390534 7:29939939-29939961 CAGGAGTGTCAGACCAGCCTGGG + Intronic
1023305312 7:38819689-38819711 GAGTGGTGTCAGAGAAGCCAGGG - Intronic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023813144 7:43927690-43927712 CTTGGGTGTCAGACAGACCTGGG + Intronic
1024075598 7:45816357-45816379 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1025046625 7:55697595-55697617 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1025051855 7:55739436-55739458 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025128813 7:56365104-56365126 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025177194 7:56807985-56808007 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025283328 7:57643832-57643854 CAGTAGGGTCAGAATGGCCTGGG - Intergenic
1025694598 7:63768401-63768423 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1026437556 7:70413039-70413061 CAGTAGTGCCAGACAGGGCATGG - Intronic
1026587060 7:71664399-71664421 CAGGAGTGTGAGACCGGCCTGGG + Intronic
1026588174 7:71674723-71674745 CAGGAGTGTGAGACAAGCCTGGG - Intronic
1026595069 7:71727502-71727524 CAGTGGGGTCACATAGGCATGGG - Intergenic
1026601831 7:71783951-71783973 CAGTGGTTTCAGAAATGTCTGGG - Exonic
1026747220 7:73022813-73022835 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1026750870 7:73050956-73050978 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1026754519 7:73079066-73079088 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1026758171 7:73107099-73107121 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1026954844 7:74370626-74370648 CAGGGGTGTGAGACAGGGCTGGG - Intronic
1027033324 7:74907384-74907406 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1027089234 7:75286385-75286407 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
1027092877 7:75314313-75314335 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
1027096520 7:75342280-75342302 CAGGAGTTTGAGACAGGCCTGGG - Intergenic
1027125323 7:75552910-75552932 CAGAAGTTTGAGACAGGCCTAGG - Intronic
1027322827 7:77025400-77025422 CAGGAGTTTGAGACAGGCCTGGG + Intergenic
1028118150 7:87024943-87024965 CAGTGATGTAAGGCAGGCATGGG - Intronic
1028433927 7:90779460-90779482 CAGGGGTTTGAGACATGCCTGGG - Intronic
1029397628 7:100319254-100319276 CAGGAGTTTGAGACAGGCCTGGG - Intronic
1031398780 7:121305972-121305994 CAGGGGTGTGAGACCTGCCTGGG - Intergenic
1032088684 7:128898262-128898284 CAGTGGTTTGAGACCAGCCTGGG - Intronic
1034607532 7:152331097-152331119 CAGGAGTTTCAGACTGGCCTGGG + Intronic
1034690473 7:153009714-153009736 CAGTTGTTTGAGACAAGCCTGGG - Intergenic
1034756218 7:153622911-153622933 CCAAGGTGTCAGCCAGGCCTGGG + Intergenic
1035034320 7:155885271-155885293 CAGAGGGGCCAGGCAGGCCTAGG + Intergenic
1035134218 7:156684746-156684768 GAGGGGTTTGAGACAGGCCTGGG + Intronic
1035167948 7:157002784-157002806 CGGTGTTTTCAGACAGGCCCAGG - Intronic
1035929786 8:3767320-3767342 CAGTGGAGTCATACTGACCTGGG + Intronic
1036025190 8:4899855-4899877 CTCTGGTGTCAGACATACCTGGG + Intronic
1036499156 8:9297432-9297454 CAGTGGTTGGAGACAAGCCTGGG + Intergenic
1037052933 8:14399338-14399360 CAGTAGAATCTGACAGGCCTGGG + Intronic
1037449229 8:19000180-19000202 CAGTGGTTTGAGACCAGCCTGGG + Intronic
1037765794 8:21771490-21771512 CAGTGCTGCCTGACAGGCCCTGG - Intronic
1038007060 8:23440875-23440897 CCGTGGAGCTAGACAGGCCTGGG - Intronic
1038434799 8:27527963-27527985 CTTTGGAGTCAAACAGGCCTAGG - Intronic
1038826532 8:31008823-31008845 CCTTGGTGTCAGCCAGTCCTGGG - Intronic
1039288813 8:36071835-36071857 CAGAGGTGTCAGACCAGCCTAGG + Intergenic
1040048862 8:42991795-42991817 CAGGGGTGTGAGACCTGCCTGGG - Intronic
1041733877 8:61089708-61089730 CAGTGGTATGAGACTAGCCTGGG + Intronic
1041863742 8:62544209-62544231 CAGGGGTTTCAGACCAGCCTGGG - Intronic
1042008901 8:64216461-64216483 CAGGGGTTTCAGACCAGCCTAGG + Intergenic
1042274212 8:66986228-66986250 CAGTGATGTCAGGCAGGGCGCGG - Intronic
1042648014 8:71008875-71008897 CAGAAGTTTGAGACAGGCCTGGG - Intergenic
1043134748 8:76507217-76507239 CTGTGGTGTTTGACAGGTCTTGG - Intergenic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1046533868 8:115483321-115483343 CAGGAGTGTAAGACCGGCCTGGG + Intronic
1046612263 8:116439153-116439175 CATTGGAGTCAGACAGATCTGGG - Intergenic
1047752370 8:127891472-127891494 ATGTGGAGGCAGACAGGCCTGGG + Intergenic
1048037210 8:130688643-130688665 CAGTGGTGTCAGTCAGGGACTGG - Intergenic
1049220290 8:141425857-141425879 GTTTGGGGTCAGACAGGCCTTGG + Intronic
1050791544 9:9477162-9477184 TTGTGGAGTCAGACAGTCCTGGG - Intronic
1050985521 9:12076985-12077007 CAGTGGTTTGAGACCAGCCTGGG - Intergenic
1051121473 9:13756790-13756812 CAGTGGTGTCAGAGAAATCTGGG + Intergenic
1052913118 9:33902125-33902147 CAGTAGTTTGAGACTGGCCTGGG - Intronic
1053017020 9:34667667-34667689 CAGAGGGGGCAGACAGGACTGGG + Intergenic
1053064968 9:35061733-35061755 CAGAGGTAAGAGACAGGCCTAGG + Intronic
1053137562 9:35660992-35661014 GATTGGTGACAGTCAGGCCTGGG + Exonic
1055104944 9:72502460-72502482 CTGTGGAGTCAGACAGATCTAGG - Intergenic
1057119593 9:92559240-92559262 CTGTGGTGTCAGGCAGGAATGGG + Intronic
1057336109 9:94156534-94156556 CAGCAGTGTCTGCCAGGCCTGGG + Intergenic
1057405749 9:94769287-94769309 CTGTGATGTCAGACATGCATAGG + Intronic
1059339107 9:113587394-113587416 CTGTGGAGTCAGACAGACCCAGG + Intronic
1059367149 9:113795092-113795114 CAATGGAGTCACTCAGGCCTGGG - Intergenic
1059485898 9:114626611-114626633 CCCTGGAGTCAGACAGCCCTGGG - Intronic
1059486723 9:114632935-114632957 CAATAGTGTCAGACAGCCCTGGG - Intronic
1059727874 9:117027267-117027289 CTGTGGAGTCAGACATACCTAGG - Intronic
1060020871 9:120130012-120130034 CAGGGGTGTCAGAGAAGCCCAGG + Intergenic
1060788053 9:126465917-126465939 CTTTGGTGTCAGACAGCCCTAGG - Intronic
1061021443 9:128018063-128018085 CAGGAGTTTCAGACTGGCCTGGG + Intergenic
1061102530 9:128503213-128503235 CAGGAGTTTCAGACAAGCCTGGG - Intergenic
1061367261 9:130178493-130178515 AAGGGGTTTAAGACAGGCCTTGG - Intronic
1061369864 9:130192123-130192145 CAGTGGTGGCAGACAGGTATGGG + Intronic
1061704211 9:132440120-132440142 CAGGAGTTTGAGACAGGCCTGGG + Intronic
1062084213 9:134640701-134640723 CAGAGATGCCAGACAGGGCTGGG - Intergenic
1062376680 9:136264958-136264980 CAGGAATGTGAGACAGGCCTGGG - Intergenic
1062438029 9:136555487-136555509 CTGTGACCTCAGACAGGCCTCGG - Intergenic
1062544527 9:137055530-137055552 CAGGGGTGGAAGAAAGGCCTGGG - Intergenic
1187272429 X:17791394-17791416 CAGTGGTGTCAGAACGGGATGGG - Intergenic
1188429364 X:30088832-30088854 CAGGAGTTCCAGACAGGCCTGGG + Intergenic
1188506646 X:30890575-30890597 GAGCGGTGTCTGACAGGCATAGG + Intronic
1189564791 X:42230570-42230592 CTTTGGCGTCAGACAGACCTGGG + Intergenic
1192342244 X:70273595-70273617 CTTTGGAGTCAGACAGGCCTGGG + Intronic
1192430631 X:71109166-71109188 CAGTGGTGTTAGAAAGGCTGGGG + Intronic
1192550274 X:72047993-72048015 CAGTGTGGACAGACAGGTCTGGG - Intergenic
1193154504 X:78158442-78158464 CTGTGGTGTCAGGCAGGAATAGG - Intergenic
1193764124 X:85505016-85505038 CAGAGGTTTGAGACTGGCCTAGG - Intergenic
1194291796 X:92082118-92082140 CTGTGGTGTCAGGTAGGCCTGGG - Intronic
1194843300 X:98772071-98772093 CAGGAGTTTCAGACAGGCCTGGG + Intergenic
1195041908 X:101022278-101022300 CAGGAGTGTAAGACAAGCCTAGG + Intronic
1195049990 X:101088401-101088423 CAGGAGTTTGAGACAGGCCTAGG + Intronic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1195892678 X:109712764-109712786 CAGGGGTTTCAGACCAGCCTGGG + Intronic
1196248520 X:113429287-113429309 TAGTGGTTGCACACAGGCCTTGG + Intergenic
1197699038 X:129583212-129583234 CACTGGTGTTGGACAGGCTTGGG - Intronic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1198799925 X:140438283-140438305 CATTGGCTTCAGACAAGCCTTGG + Intergenic
1199167753 X:144697390-144697412 CAGTAGTTTAAGACAAGCCTGGG + Intergenic
1199592179 X:149477569-149477591 CAGTGATGTCAGGCAGGGCATGG + Intergenic
1200088451 X:153623363-153623385 CAGTGGTGTCAGGGAGCTCTGGG - Intergenic
1200609311 Y:5306690-5306712 CTGTGGTGTCAGGTAGGCCTGGG - Intronic
1201666309 Y:16460126-16460148 CAGGGGTTTGAGACTGGCCTGGG + Intergenic