ID: 1176911775

View in Genome Browser
Species Human (GRCh38)
Location 21:14574192-14574214
Sequence AATTATGGACAATCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176911775 Original CRISPR AATTATGGACAATCTGAGGT GGG (reversed) Intronic
907932562 1:59014260-59014282 AATTTTGGACAATATCATGTAGG + Intergenic
911218202 1:95218518-95218540 AAATATTTTCAATCTGAGGTTGG - Intronic
913189801 1:116403978-116404000 AATTATGGGCATTCTGACTTTGG + Intronic
921932138 1:220763294-220763316 AATTGTAGCAAATCTGAGGTTGG + Intronic
921990153 1:221357201-221357223 AATTCTGCATAATCTGAGATTGG - Intergenic
922116729 1:222620016-222620038 GATGATGGACAATTTAAGGTTGG - Intronic
1062822576 10:545892-545914 AATCATGGACAATTTGTTGTCGG + Intronic
1064913795 10:20434278-20434300 AATTTTTGATAGTCTGAGGTGGG + Intergenic
1065105736 10:22382145-22382167 AATTATGGAAAAACTGAGAGAGG + Intronic
1066255109 10:33670980-33671002 AATTAGTTTCAATCTGAGGTTGG + Intergenic
1069787895 10:71001113-71001135 ACTTCTGGACAAACTGTGGTAGG + Intergenic
1071230916 10:83584424-83584446 ATTTATGGACATACTGAAGTAGG - Intergenic
1075538647 10:123294068-123294090 AAATATGCACTATCAGAGGTCGG + Intergenic
1080986932 11:37479756-37479778 AATTATGGAAAATATCAGGAAGG - Intergenic
1081178439 11:39958042-39958064 AATTATGAACATTCTGAGAAAGG - Intergenic
1087268118 11:96083123-96083145 AATTCTTGACATTCTGATGTCGG + Intronic
1087560162 11:99779971-99779993 AACTATGGACAATTTGAGTGTGG - Intronic
1088618741 11:111660605-111660627 CATTATGGAAAATCTGAGGAAGG - Intronic
1091548787 12:1522364-1522386 AAATATTGTCAATCTGAGGTTGG + Intergenic
1092402486 12:8188628-8188650 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1094167742 12:27459847-27459869 AATTCTGGACAATGTGAGTTAGG - Intergenic
1095811357 12:46375515-46375537 AATGCCTGACAATCTGAGGTAGG + Intergenic
1096695865 12:53347784-53347806 AACTATGGAAAAGCTGAGGATGG + Intergenic
1104663012 12:130625760-130625782 AATTTTGGTCATTCTGGGGTTGG - Intronic
1106232880 13:27834976-27834998 AAATATTTTCAATCTGAGGTTGG + Intergenic
1107439182 13:40409361-40409383 ACTTATTGTCAAGCTGAGGTGGG + Intergenic
1109335742 13:60991232-60991254 AAATATGGGCAACCTGAGGAGGG + Intergenic
1110854633 13:80282949-80282971 AAGAATGGATAATCTGAGATAGG - Intergenic
1111818335 13:93183072-93183094 AATTATGCACACTGTGAGGAGGG - Intergenic
1112563654 13:100534390-100534412 AATTAAGGAGAACCTGGGGTAGG + Intronic
1113302039 13:109032983-109033005 AATTATGGATAATCTTAGCTAGG + Intronic
1119162417 14:72463774-72463796 AATTAGGGACAACCTCAGGCAGG - Intronic
1120105139 14:80485478-80485500 AGTTATACACAATTTGAGGTTGG - Intronic
1124875844 15:33592536-33592558 AATTCTGGCCAATCGGAAGTGGG - Intronic
1125838193 15:42772698-42772720 GATTATAGACAGGCTGAGGTAGG + Intronic
1127185430 15:56474742-56474764 TATTTTGGATAATGTGAGGTAGG + Intergenic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127792551 15:62411216-62411238 AATTATGGCCACTATGCGGTGGG - Intronic
1129141068 15:73598400-73598422 AATTATGGGCAATTAGAGGTAGG - Intronic
1133462413 16:5998718-5998740 AATTATGGACAATCAGAGACTGG - Intergenic
1138756106 16:59487523-59487545 AATTCTGTAAAATATGAGGTTGG + Intergenic
1143179810 17:4977475-4977497 AGTTATGAACAATTTGATGTTGG + Intronic
1147030230 17:37628023-37628045 AGCTATGGAGAAGCTGAGGTGGG - Intronic
1149189876 17:54048721-54048743 AATTGTGGACAATCTGTATTTGG + Intergenic
1156721309 18:40073288-40073310 AATTTTGCAGAAACTGAGGTGGG + Intergenic
1158112915 18:53961734-53961756 ATTTATTAAAAATCTGAGGTTGG - Intergenic
1161115156 19:2492714-2492736 AATGATGGAAAATCACAGGTGGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165914925 19:39252663-39252685 AATTTAGGATAATTTGAGGTGGG + Intergenic
1166298931 19:41903467-41903489 ACTTCTGGACAGGCTGAGGTAGG - Intronic
1168716282 19:58529763-58529785 AAATATGCAGAATCTGGGGTGGG - Intronic
926875724 2:17476148-17476170 AATTCAGCACATTCTGAGGTAGG + Intergenic
930361666 2:50388145-50388167 CATTTTGGGCAATCTGGGGTGGG + Intronic
931923803 2:67049012-67049034 AACTCTGGATTATCTGAGGTGGG - Intergenic
932459508 2:71873215-71873237 AATGATGGAGACTCTGAGGGAGG - Intergenic
934766849 2:96884514-96884536 AATCATGAGTAATCTGAGGTAGG + Intronic
936863650 2:117052904-117052926 CATCATGGAGCATCTGAGGTGGG - Intergenic
1170070848 20:12365110-12365132 AATTATGTGCAATATGAAGTTGG - Intergenic
1170116256 20:12863360-12863382 ACTTATAGACAATCTAAGGTAGG + Intergenic
1171826261 20:29911158-29911180 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826392 20:29913722-29913744 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826450 20:29914918-29914940 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826520 20:29916286-29916308 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826712 20:29920220-29920242 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826783 20:29921591-29921613 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826896 20:29923813-29923835 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171826965 20:29925180-29925202 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827038 20:29926548-29926570 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827165 20:29929280-29929302 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827375 20:29933383-29933405 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827511 20:29936116-29936138 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827557 20:29936975-29936997 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827628 20:29938342-29938364 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827697 20:29939709-29939731 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827765 20:29941076-29941098 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171827986 20:29945521-29945543 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828056 20:29946888-29946910 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828129 20:29948258-29948280 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828197 20:29949625-29949647 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828267 20:29950992-29951014 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828438 20:29954237-29954259 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828576 20:29956972-29956994 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828649 20:29958339-29958361 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828718 20:29959706-29959728 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828805 20:29961416-29961438 ATTTTTGTACAATCTGTGGTTGG + Intergenic
1171828877 20:29962784-29962806 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171828950 20:29964154-29964176 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829017 20:29965523-29965545 ATTTTTGTACAATCTGTGGTTGG + Intergenic
1171829161 20:29968258-29968280 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829233 20:29969625-29969647 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829301 20:29970992-29971014 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829374 20:29972359-29972381 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829524 20:29975096-29975118 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829665 20:29977834-29977856 ATTTTTGTACAATCTGTGGTTGG + Intergenic
1171829777 20:29979639-29979661 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829847 20:29981007-29981029 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171829916 20:29982371-29982393 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830030 20:29984593-29984615 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830099 20:29985960-29985982 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830171 20:29987326-29987348 ATTTTTGTACAATCTGTGGTTGG + Intergenic
1171830245 20:29988693-29988715 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830317 20:29990060-29990082 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830384 20:29991425-29991447 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830455 20:29992794-29992816 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830594 20:29995526-29995548 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830671 20:29996901-29996923 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830811 20:29999636-29999658 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830880 20:30001003-30001025 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171830953 20:30002370-30002392 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831027 20:30003736-30003758 ATTTTTGTACAATCTGGGGTTGG + Intergenic
1171831102 20:30005103-30005125 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831173 20:30006470-30006492 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831247 20:30007839-30007861 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831319 20:30009206-30009228 ATTTTTGTACAATCTGCGGTAGG + Intergenic
1171831390 20:30010574-30010596 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831462 20:30011940-30011962 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831535 20:30013309-30013331 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831605 20:30014675-30014697 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831738 20:30017408-30017430 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831877 20:30020266-30020288 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171831971 20:30022146-30022168 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832040 20:30023513-30023535 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832108 20:30024882-30024904 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832312 20:30028985-30029007 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832379 20:30030352-30030374 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832460 20:30031945-30031967 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832531 20:30033312-30033334 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832601 20:30034681-30034703 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832645 20:30035536-30035558 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832717 20:30036893-30036915 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832788 20:30038262-30038284 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832824 20:30088915-30088937 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832923 20:30090800-30090822 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171832994 20:30092168-30092190 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833075 20:30093708-30093730 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833113 20:30094394-30094416 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833252 20:30097014-30097036 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833346 20:30098819-30098841 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833416 20:30100186-30100208 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833479 20:30101385-30101407 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833505 20:30101900-30101922 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833569 20:30103152-30103174 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833639 20:30104519-30104541 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833743 20:30106560-30106582 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171833815 20:30107927-30107949 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834067 20:30112879-30112901 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834168 20:30114928-30114950 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834289 20:30117330-30117352 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834359 20:30118697-30118719 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834444 20:30120365-30120387 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834493 20:30121224-30121246 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834702 20:30125324-30125346 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834774 20:30126689-30126711 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834879 20:30128156-30128178 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834905 20:30128671-30128693 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834932 20:30129186-30129208 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171834984 20:30130208-30130230 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171835046 20:30131527-30131549 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171835188 20:30134259-30134281 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1171835264 20:30135788-30135810 ATTTTTGTACAATCTGCGGTTGG + Intergenic
1174918762 20:54680168-54680190 AATTATAGAAATCCTGAGGTGGG + Intergenic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1177510904 21:22086679-22086701 AATTGTGCACACTCTGAGGCTGG - Intergenic
1181273499 22:21674257-21674279 AAGTCTGGACAACCGGAGGTGGG - Intronic
949340081 3:3020211-3020233 ACTTATGGACAATCTGTGAGTGG - Intronic
952558329 3:34559406-34559428 AATTTTATACAATGTGAGGTGGG + Intergenic
954440321 3:50518206-50518228 ACTGATGGGCAAACTGAGGTTGG - Intergenic
956827565 3:73012608-73012630 AAATATTTTCAATCTGAGGTTGG + Intronic
960856437 3:122107119-122107141 ATTTATGGGCATTCAGAGGTAGG + Intronic
962294568 3:134170712-134170734 GATTATGGACTATCTAAGGGAGG + Intronic
964275722 3:155006886-155006908 AAATATTGTCAATCTGTGGTTGG - Intergenic
965457781 3:168925308-168925330 AATTATGTACAATAAGTGGTGGG - Intergenic
965515537 3:169617700-169617722 GATTCTGGCCAATATGAGGTAGG - Intronic
967259510 3:187628034-187628056 AATTTTGGAAATTCTGAAGTAGG + Intergenic
969118011 4:4885998-4886020 CAATGTGGACAATCTGTGGTTGG - Intergenic
969259274 4:6023317-6023339 AAATATGAACAAACTGATGTCGG - Intergenic
969778150 4:9374972-9374994 AAGTATGGAAAAAATGAGGTAGG - Intergenic
971189013 4:24409278-24409300 AAAGATGGACATGCTGAGGTTGG - Intergenic
971191695 4:24434693-24434715 GTTTATGAACAATCTGATGTTGG - Intergenic
971660125 4:29403116-29403138 AGTTTTGGACAATCACAGGTCGG + Intergenic
974614155 4:64260308-64260330 AATTATTGACAATGTGATTTTGG + Intergenic
975298988 4:72767039-72767061 AATTCTGGACACAGTGAGGTAGG + Intergenic
976069685 4:81227061-81227083 AGTTATAGACAATCTGGGTTTGG - Intergenic
978175161 4:105721216-105721238 AATTCTGGAAAACATGAGGTGGG - Intronic
978312948 4:107406118-107406140 AATTATGCCCCATCTGAAGTAGG + Intergenic
978384292 4:108165956-108165978 AATTGTGGAGAATATGAAGTGGG + Intronic
979724674 4:123946147-123946169 AATTAAGAATAATCTCAGGTTGG - Intergenic
981278431 4:142929061-142929083 AAATATGAACAATCTGGGGAAGG + Intergenic
981977056 4:150743483-150743505 TATTATGAACAATATGAGCTTGG + Intronic
983619025 4:169740225-169740247 AAATATGGAAAATATGAAGTTGG + Intronic
987786785 5:22510743-22510765 AATTATGTTCAATCTATGGTTGG + Intronic
988120490 5:26954921-26954943 AATTTAGGAGAGTCTGAGGTGGG + Intronic
988977202 5:36527086-36527108 AATTATGGAAAATGTGAGGAAGG + Intergenic
990249370 5:53896977-53896999 AATTATCTAGAATCTTAGGTGGG - Intronic
990335338 5:54767038-54767060 GATTATGGACTATCTGATGAAGG - Intergenic
991351868 5:65727588-65727610 CATGCTGTACAATCTGAGGTAGG - Intronic
991397040 5:66214900-66214922 AAGTATGGAAAATATTAGGTTGG - Intergenic
992913441 5:81422247-81422269 AATTATAGACAAGCTGAGACCGG + Intronic
992915241 5:81444157-81444179 AAATAGGGTCAACCTGAGGTAGG - Intronic
998917325 5:147029221-147029243 AAATATTGACAACCTTAGGTAGG - Intronic
1000968489 5:167688075-167688097 ATTTATGGAGAAACTGAGGGAGG + Intronic
1001006313 5:168053530-168053552 AAATATTTTCAATCTGAGGTTGG - Intronic
1005623794 6:27644672-27644694 AATTGAGGTCAATCAGAGGTGGG - Intergenic
1006723763 6:36180630-36180652 AATTATAGACAATCTCACTTTGG + Intergenic
1016379817 6:143464594-143464616 AATTCTGGAGAATTTAAGGTGGG + Intronic
1017352736 6:153461241-153461263 AATTCTAGATAATCTGAGGAGGG - Intergenic
1017768199 6:157624150-157624172 AATTAGGCACAAGCTGAGCTGGG - Intronic
1017937449 6:159018876-159018898 AATTATGGAGCATTTGAAGTTGG + Intergenic
1023161827 7:37304319-37304341 AAGTCAGGACAATCTGAGGAGGG + Intronic
1023341415 7:39224810-39224832 AATTCTGGAAAAGCTGTGGTGGG - Intronic
1026439737 7:70433622-70433644 AAATGTAGACAATCTGAGGTTGG + Intronic
1030914604 7:115296834-115296856 AATTCTGGCCAAGGTGAGGTAGG - Intergenic
1033509458 7:142040433-142040455 ACTGATGGACAATGTGAGCTTGG + Intronic
1033999586 7:147395798-147395820 AAGTTTGGACAACGTGAGGTAGG - Intronic
1036275607 8:7348968-7348990 AAGTATGGAAAAAATGAGGTAGG - Intergenic
1036345739 8:7961389-7961411 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1036841074 8:12122143-12122165 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1036862874 8:12368395-12368417 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1038968362 8:32602672-32602694 AATTATGAACAATATCAGGGTGG - Intronic
1038979593 8:32743680-32743702 AATTATGTACAATGTGAATTGGG - Intronic
1039147110 8:34460557-34460579 AATTATGGAGAATTTTAGGGTGG + Intergenic
1041316364 8:56567181-56567203 TATTATGGACAATCTCAAATAGG + Intergenic
1043648754 8:82559995-82560017 ATTCATGGACAATGTGAGGAGGG + Intergenic
1043840105 8:85093053-85093075 AAATATTGACAATCTGTGGCCGG + Intergenic
1044556114 8:93563675-93563697 AAGTATTGACTAGCTGAGGTTGG - Intergenic
1045468833 8:102493075-102493097 AATTATGGATAATTGGAGGAGGG - Intergenic
1048684815 8:136892652-136892674 CATTATGGGCAAGCTGAGGTAGG + Intergenic
1048691064 8:136963893-136963915 AATAATGGTCATTTTGAGGTTGG - Intergenic
1052099627 9:24429408-24429430 ATTTATGAAGAATCTGAGGAAGG - Intergenic
1186916407 X:14227071-14227093 AATTATGAAAGATCTGAGGGTGG + Intergenic
1187110024 X:16288449-16288471 ATTTAAGAACAATCTGAGGAAGG - Intergenic
1188444027 X:30238084-30238106 AATCAGGGAGAATCTGGGGTAGG + Intergenic
1188993243 X:36850291-36850313 ACTGATGTACAATATGAGGTTGG - Intergenic
1192882056 X:75296124-75296146 AATCATGGCCTATCTGAGGTTGG + Intronic
1195029497 X:100912595-100912617 AATTGTGAACAATCTGACCTAGG - Intergenic
1195956928 X:110341495-110341517 AATTATGGACGATTTTAAGTAGG + Intronic
1197343588 X:125304553-125304575 ATTTATAAACTATCTGAGGTTGG - Intergenic
1197832079 X:130653782-130653804 AATAATGGAAAATAAGAGGTGGG + Intronic
1199224047 X:145351654-145351676 AACTATGGACAATCTTAAGTGGG - Intergenic
1200118408 X:153779221-153779243 AATTAGAAACAATCTCAGGTGGG - Exonic