ID: 1176914448

View in Genome Browser
Species Human (GRCh38)
Location 21:14608309-14608331
Sequence AGGGAGAGCAAAGTTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 7, 2: 44, 3: 100, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176914440_1176914448 25 Left 1176914440 21:14608261-14608283 CCTGGTAGCATCCTCATGGTGCT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG 0: 1
1: 7
2: 44
3: 100
4: 336
1176914441_1176914448 14 Left 1176914441 21:14608272-14608294 CCTCATGGTGCTGAGAGAGAATA 0: 1
1: 0
2: 7
3: 43
4: 265
Right 1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG 0: 1
1: 7
2: 44
3: 100
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176914448 Original CRISPR AGGGAGAGCAAAGTTATTGT GGG Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905126127 1:35717430-35717452 GGGGAGAGGAAGGATATTGTAGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907776776 1:57523532-57523554 AGCGAAAGCAAAGATATTGCAGG + Intronic
907829916 1:58055116-58055138 TGGGAGAGCAATGTTCATGTGGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909299221 1:73989992-73990014 AGGGAGTGAAAATTGATTGTTGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912969024 1:114262985-114263007 AGGAAGAGGAAAGTCATTGCAGG + Intergenic
913319450 1:117578120-117578142 ATGGAGAGGAAAGTTGTTGAGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916965216 1:169932240-169932262 ACAGAGAGGAAAGTTCTTGTTGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919132009 1:193463221-193463243 AGGGAGAGAAATTCTATTGTAGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919262521 1:195215819-195215841 AGGGAGAGCACAGATAATTTAGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919657013 1:200207012-200207034 GGGGAGGGCAAAGGTATTTTTGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921570487 1:216772322-216772344 AGAGAGAGCAGAGTTCTTTTGGG - Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
1062831604 10:609209-609231 AAGGAGAGCAGAGGTATTGGTGG - Intronic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1064717279 10:18189879-18189901 AGGCAAAGAAAAGTGATTGTTGG + Intronic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068446082 10:57125483-57125505 ATGAAGTTCAAAGTTATTGTGGG - Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069699261 10:70409247-70409269 AGGAAGAGGAAACTTTTTGTTGG + Intronic
1070635164 10:78119711-78119733 AGGGAAAACAAAGTTAGAGTGGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1071973343 10:90930490-90930512 AAGGAGAGCAAAGATCTTGGAGG - Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073104245 10:101023234-101023256 TGGGAGAGCAGAGCTATTGGAGG + Intronic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078739548 11:14053622-14053644 AGGGACTGAAAAGTTAATGTAGG - Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080115530 11:28617591-28617613 AGGAAGAGGAAAGCCATTGTAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081297008 11:41403640-41403662 GGGAAGAGCCAAGTTTTTGTCGG - Intronic
1081829128 11:46091465-46091487 AGAGAGAGAAATGTAATTGTGGG - Intronic
1083514645 11:63245318-63245340 ATGGAAAGTAAAGTTATTGCGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091708722 12:2721697-2721719 TGGGAGAGAGAAGTTAATGTAGG - Intergenic
1091885540 12:4014684-4014706 GGGGAGAGCAGAGTTAGTGATGG + Intergenic
1091920588 12:4301279-4301301 ATGGAAAGAAAAGTTATTGCTGG + Exonic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094026427 12:25964110-25964132 GAGGAGAGGAAAGTTATGGTTGG + Intronic
1094031051 12:26011374-26011396 AGGAAGAGGAAAGTTCTTCTGGG - Intronic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095808936 12:46351080-46351102 AGGGAGAGAAAGGGTATGGTGGG - Intergenic
1096860258 12:54521479-54521501 AGTGAGAGCACAGATTTTGTTGG - Intronic
1097899384 12:64857843-64857865 ATGGAGAGCAAAGTTGTGCTGGG - Intronic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1098851375 12:75600416-75600438 GTGGAGAGCAAAGTTAGTGCTGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101239139 12:102820688-102820710 AGGGAGACCAAAGTTGATGTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1103108506 12:118253088-118253110 AGTGGGAGCCAAGTTATTGATGG + Intronic
1104781590 12:131424039-131424061 AGGGAGATCAAAGTTAATAAGGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1109554629 13:63955819-63955841 AGGGAGAGCAAAGGGAGTATGGG - Intergenic
1109781803 13:67120449-67120471 AGGTAAAGCAAAGTTGTTGGTGG - Intronic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111568677 13:90049014-90049036 AGGGAGAGCAAAATGAATATGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114993727 14:28319588-28319610 AGAGAGAGAAAAGTTGTTATTGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116041963 14:39696948-39696970 AGGGAGAAAAAAATTCTTGTAGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1117018088 14:51539557-51539579 AGGGGGAGCAAATTTAAAGTTGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117843768 14:59889205-59889227 AGGGAGACCAAAGTTATCACTGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119802196 14:77455777-77455799 AGGGATAGCAAGGGTATTGTGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121165054 14:91787100-91787122 AGGGAGAGAAAAGTGTTTCTAGG + Intronic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1123157010 14:106236824-106236846 AGGGAGAGGCAAGTTCTTGTAGG + Intergenic
1123216254 14:106812206-106812228 AGAGAGAGACAAGTTTTTGTAGG + Intergenic
1123794049 15:23753803-23753825 AGTGAGAGCAAAGCCATTATGGG - Intergenic
1126550747 15:49926518-49926540 AGGGAGAGGGAAGCTATTGCAGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1132187590 15:99815364-99815386 AGGGAAAGGAAAGTTACTGATGG + Intergenic
1133958792 16:10472891-10472913 AGAGAGAGAAAAGTTATCATTGG - Intronic
1136873137 16:33825871-33825893 AGAGAGAGACAAGTTCTTGTAGG - Intergenic
1140133685 16:72186217-72186239 AATGAGAGAAAAGTTATTCTGGG - Intergenic
1140548960 16:75842763-75842785 AGAGATATCAGAGTTATTGTGGG + Intergenic
1203099035 16_KI270728v1_random:1290184-1290206 AGAGAGAGACAAGTTCTTGTAGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148012416 17:44494008-44494030 ATGGAGAGCAAGATCATTGTAGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149199544 17:54166863-54166885 AGGGAGAGCAAGGATAAAGTGGG + Intergenic
1150331825 17:64300613-64300635 AGAGAGAGCAAAGCTTTTCTAGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1159474040 18:68894998-68895020 AAGGAGAGCAAATGTATTTTTGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160597011 18:79982720-79982742 AGAGAGAGGGAAGTTACTGTGGG + Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
925967256 2:9077517-9077539 AGGGACAGCAATGTGATTGATGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926977122 2:18526220-18526242 AGGGAAGGAAAGGTTATTGTGGG + Intergenic
928362929 2:30680133-30680155 AAGGAGAGCAAAGTTTTGGGAGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928485622 2:31728515-31728537 AGGGAGAGCAAATTATGTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
928902778 2:36338433-36338455 AGAGAGACCAAAATTATTCTTGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931411935 2:62041095-62041117 AGGAAGAGCAAAGTTTCTGGTGG - Intronic
931627216 2:64267698-64267720 AGGGGGAGCAGGGTTATTCTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932439256 2:71721495-71721517 TGGGAGAGCTGAGTTATTTTGGG - Intergenic
932569254 2:72929378-72929400 AGGGAGATCATGGTTATGGTTGG + Intronic
935022284 2:99243277-99243299 AGAAAGAGCAAATTTATAGTGGG + Intronic
935179688 2:100678254-100678276 AGGGAGCTCACATTTATTGTGGG - Intergenic
935431481 2:102980592-102980614 AGGGAGAGGAAACTTACTGAGGG - Intergenic
936080913 2:109432054-109432076 AGGGTGAGCTAAGCTATTCTTGG - Intronic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940461489 2:153968382-153968404 AGGGACAGCAAAGGAAGTGTGGG - Intronic
940469403 2:154076087-154076109 AGGGAGAGCAGAGCTGCTGTTGG - Intronic
940532139 2:154891545-154891567 AGGAATAGCAAGGTTATTGATGG + Intergenic
940780059 2:157923949-157923971 AGGAAGAGTAACCTTATTGTGGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940840722 2:158578113-158578135 ACTGAGAGAAAAGTTATTGCAGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944452078 2:199853409-199853431 AGGGAGAACTTAGTTCTTGTAGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168823200 20:791047-791069 GGGGAGAGCAAAGTTATACCTGG + Intergenic
1169597185 20:7213871-7213893 AGGGAGCACAAAGGGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170736820 20:19020100-19020122 GGGGAGAGCAAGGTTATGGCAGG + Intergenic
1170929181 20:20753534-20753556 AGGGACAGCAAAGATACAGTGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172962435 20:38807952-38807974 AGGGAGAGCAAAGTCTGAGTGGG - Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174116790 20:48231723-48231745 AGGCAGTGCAAAGTCATTGGTGG - Intergenic
1175063467 20:56264871-56264893 GGGGAGAACAGAGTTTTTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177239958 21:18443640-18443662 AGGTGGAGCAATCTTATTGTTGG - Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177637916 21:23809325-23809347 AGTGAGAAAAATGTTATTGTAGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181504308 22:23341271-23341293 AGGGAGAGCAAAGACATTACAGG + Intergenic
1181594331 22:23904591-23904613 GGGGACAGCATAGTTACTGTGGG + Intergenic
1181655417 22:24293882-24293904 AGGGAGAGCAAAGACATTACAGG + Intronic
1181709296 22:24671505-24671527 AGGGAGAGCAAAGACATTACAGG + Intergenic
1184927905 22:47657114-47657136 AAGGCGTGCCAAGTTATTGTAGG + Intergenic
950414061 3:12858330-12858352 AGAGAGAGCAAAAGAATTGTGGG + Intronic
950670624 3:14523219-14523241 TGGGAGGGCGAATTTATTGTTGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951659192 3:25043605-25043627 AGGGAGAGAAAAGATAAAGTAGG + Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
956248699 3:67213156-67213178 AGGGAGTGAAAAGTTATTCAAGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956623458 3:71244373-71244395 GGGGAGGGCCAAGTTATTTTGGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958052233 3:88363066-88363088 AGGGAGAGTAAAAGTGTTGTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959850312 3:111078232-111078254 AGGAAGAGCAATGTCATTCTAGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960720033 3:120616636-120616658 AGGGAGAGTCAAGGTGTTGTAGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961337690 3:126192455-126192477 AGAGAGATCAAAGATATTGCAGG + Intronic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963627425 3:147690817-147690839 AGGGAGAGGAAAGATTTTGATGG - Intergenic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964336542 3:155660662-155660684 ATGGATAGAAAAGTTATTTTAGG - Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964610663 3:158611763-158611785 ATGGTGAGCAAAAGTATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
965914240 3:173822064-173822086 AGAGAAATCAAAGTTATTCTAGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967376661 3:188811405-188811427 AGGGAGAGAAAAATTATGATTGG + Intronic
967464923 3:189793657-189793679 GGGGAGAGAAAAGTTATACTAGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
971355336 4:25890229-25890251 AAGGATAGCAAAATTAATGTTGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972784196 4:42311834-42311856 ATGGAGTGCAAAGGAATTGTGGG - Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973603974 4:52568776-52568798 AGGGACAGCAAATTATTTGTTGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974285756 4:59865011-59865033 AGGGAGAGCCAAATGATTCTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975940918 4:79644557-79644579 AGTGCTAGCATAGTTATTGTTGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977046450 4:92073505-92073527 AGCAGGAGCAAAGTTGTTGTGGG - Intergenic
977125734 4:93165251-93165273 AGAGAGAGCAATGTCATAGTAGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978836540 4:113157121-113157143 TGGGAGAGAAAACTTATTATGGG + Intronic
979798378 4:124876023-124876045 AGGCAGTGGAAAATTATTGTTGG + Intergenic
979811591 4:125042917-125042939 AGGCAAAGGAAAGTTATTGACGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981223577 4:142265337-142265359 AGTGAAAGCAATGTTATTTTAGG + Intronic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981702446 4:147621302-147621324 AGGGAGAGTTAACTTATTCTTGG + Intronic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984395802 4:179198347-179198369 ATGGAAAGCAAAGTAAGTGTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987347730 5:16993450-16993472 AGGCAGAGCTAAGAAATTGTAGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
988885542 5:35553618-35553640 TGGGAGAACAAAATCATTGTTGG - Intergenic
989256984 5:39376756-39376778 AGGGAGAGCAGACTTCTTCTGGG - Exonic
989766551 5:45091748-45091770 AGGAAGAGCAAAATAATTCTGGG + Intergenic
989782929 5:45291199-45291221 TGAGAGAGAAAAGTTATTGGAGG - Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994114075 5:96041994-96042016 AGGGAAATCAAAGTAATTTTCGG + Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995974190 5:118010899-118010921 AGGGAGAGCAAAATCAGAGTTGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998636000 5:143955158-143955180 AGGAGGAGAAAAGTTTTTGTAGG + Intergenic
998751352 5:145324896-145324918 AGGGAAAGCAAAGTATTTGTAGG + Intergenic
999680274 5:154052031-154052053 AGTCAGAGCCAAGTTATTGAAGG + Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1003935801 6:10973974-10973996 AGAAAGAGCAAGGTTATTGTTGG + Exonic
1004476717 6:15980006-15980028 AGGAAGATTAAAGCTATTGTAGG - Intergenic
1008775769 6:55035745-55035767 AGGGAGAGCAGAGGAATTTTTGG - Intergenic
1009026776 6:58009561-58009583 AAGAAGAGTAAAGGTATTGTGGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010065306 6:71675752-71675774 GGGGAGAGGAAAGGCATTGTAGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011811042 6:91132711-91132733 AAGCAGAGCAAAGTCTTTGTTGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012523704 6:100151684-100151706 AAGCAGAGCAAAGGTCTTGTAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013456131 6:110331227-110331249 ACAGAGAGAAAAATTATTGTGGG + Intronic
1013728099 6:113126388-113126410 AGGCAGAACAAGGTTGTTGTGGG + Intergenic
1015105048 6:129526829-129526851 TGGGAGAACAAAGTTATTGAAGG + Intergenic
1015252358 6:131140515-131140537 AGGGAGAGGAAACTTAATTTTGG - Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890822 6:137968050-137968072 TGGGAGATCAAAGTGATGGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016541377 6:145169968-145169990 AGGGAAAGCAAAGTTGCTATGGG + Intergenic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020944568 7:14586172-14586194 AGCGAAGGCAAAGTTATTGAAGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023844269 7:44112272-44112294 AGGGATGGGCAAGTTATTGTTGG - Exonic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024947122 7:54819864-54819886 AAGGAGAGGAAAGTTCTTATGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027526263 7:79272971-79272993 AGAGAGACCAAAATTACTGTAGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032761185 7:134944070-134944092 AGAGAGAGCAAACTCATTTTTGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034708909 7:153173112-153173134 ATGGGGAGCAAAGATATTGGTGG + Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1037613837 8:20499280-20499302 AGGGAGTCAAAAGTTATAGTTGG + Intergenic
1039010682 8:33089726-33089748 AGGGTGAGCATAGGTATTGGAGG - Intergenic
1042754390 8:72194308-72194330 GGAGAGAGCAAAGTAATTGAGGG - Intergenic
1043198707 8:77334792-77334814 AGGCAGAGAATAGTTTTTGTTGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043246328 8:78006849-78006871 AGGAAAAGAAAAGTTTTTGTTGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046340792 8:112851953-112851975 AGGAAGAGAAAGGTTATTTTGGG + Intronic
1046399973 8:113692079-113692101 AGGAAAAGGGAAGTTATTGTGGG - Intergenic
1046406756 8:113782926-113782948 AGGAAGAACAAAGTTTTTTTCGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048580870 8:135729033-135729055 AGGGTGTGCACAGTTGTTGTGGG - Intergenic
1048652711 8:136497079-136497101 AGGGAGTCCAAAGTTATTAAAGG + Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051956812 9:22705355-22705377 AAGTAGAGAAAAGTTATTCTGGG + Intergenic
1052050194 9:23837861-23837883 AGAGAGAGAAAATTTATAGTTGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057528882 9:95826748-95826770 AAGGAGAGCAAAGAAATTGGAGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058919107 9:109596535-109596557 ATGGAAAGCAAAGTCATTCTTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061198153 9:129119800-129119822 AGGGAGGGCATGGTTATTGAAGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185833129 X:3320385-3320407 AGAGAGAGAAAAGTTATTCCAGG - Exonic
1187259760 X:17674246-17674268 AGAGAGAGCAAAGTTATAACAGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188090324 X:25956176-25956198 AAAAAGAGCAAAGTTATTTTTGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188911368 X:35851798-35851820 AGGGGGAGCTAAGAAATTGTTGG - Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191194228 X:57704204-57704226 AGGGAGAGTAAGGCTACTGTGGG - Intergenic
1192094922 X:68200479-68200501 AGGAAGGGGAAAATTATTGTTGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193856825 X:86612604-86612626 AGGGAAAGCATAGCTATTATGGG - Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194466540 X:94240735-94240757 AGAGACAGCAAAGTAATTATGGG - Intergenic
1194690195 X:96974922-96974944 AGGAAGAACAAAGATAGTGTGGG + Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199228277 X:145405739-145405761 AGGGAGAGAAAAGCTGTAGTTGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199921131 X:152405166-152405188 AGGGAGAGCAAGGTGAGTATGGG + Intronic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic