ID: 1176916632

View in Genome Browser
Species Human (GRCh38)
Location 21:14633629-14633651
Sequence CTTCATGGACAAATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176916628_1176916632 4 Left 1176916628 21:14633602-14633624 CCTAATATGATTATAGTAGAGGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 160
1176916626_1176916632 12 Left 1176916626 21:14633594-14633616 CCTGGTGGCCTAATATGATTATA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176916632 Original CRISPR CTTCATGGACAAATGGAGCA GGG Intronic
901627486 1:10632214-10632236 CTCCAGGGAGAAATGGAGCCGGG - Intergenic
903132714 1:21290157-21290179 CTGCAAGGCCAAATGCAGCACGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904950341 1:34233224-34233246 CTTGAAAGAGAAATGGAGCAGGG - Intergenic
906095024 1:43217062-43217084 CTTCCAGGACAAATGGACAAGGG + Intronic
906662831 1:47594647-47594669 CTGCATGGTCAAGTGAAGCAAGG - Intergenic
907336314 1:53702111-53702133 CTACATGGGCAAATGCAGGAGGG - Intronic
908733913 1:67256231-67256253 CTTCAGGAACAAAGGGAGTAGGG + Intronic
909426737 1:75534297-75534319 GTACCTGGACAAATGGAGCCCGG - Intronic
911946248 1:104113233-104113255 CCTCAGGGACAAATGGAACTAGG + Intergenic
912748106 1:112262749-112262771 CTCCATTTACAAATGCAGCATGG - Intergenic
914951388 1:152117992-152118014 ATTCTTGTAGAAATGGAGCAGGG - Intergenic
917710748 1:177681493-177681515 CTTCATTGGCAAATTGATCATGG + Intergenic
920350665 1:205335924-205335946 CTTCAAGGACAAGTGGAACCTGG - Intergenic
920514141 1:206571982-206572004 CTTCATGAAGACCTGGAGCAGGG + Intronic
921525223 1:216209270-216209292 CTACATGGACACAGGGAGCGGGG + Intronic
921986974 1:221322747-221322769 CTACAAGGACAAAAGGAGCCCGG - Intergenic
922793000 1:228320815-228320837 GATCATGGACAAATGGTGGATGG - Intronic
923836735 1:237618970-237618992 CTTCTTGGACATCTGGAGGAGGG - Intronic
1065988674 10:30983877-30983899 CTTTATGGACAACTGGATGAAGG - Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1074482759 10:113840616-113840638 TTTCATGGCCAAAGGGAGGAGGG - Intronic
1074486305 10:113885666-113885688 CAGCATGGACAAATATAGCAAGG + Intronic
1076933789 10:133554240-133554262 TTCCATGGAAAAATGGAACATGG - Intronic
1080726696 11:34905284-34905306 CTTGTTGTACAAATGGACCATGG - Intronic
1083613019 11:64013390-64013412 CCGCGTGGACAACTGGAGCAAGG + Intronic
1084629255 11:70335378-70335400 ACTCATGGACACAGGGAGCACGG - Intronic
1085263599 11:75223511-75223533 CTTCCTCTACAAATGGGGCAGGG + Intergenic
1087445627 11:98248616-98248638 CTTGAATGACAAATGGATCAAGG - Intergenic
1089372176 11:117969258-117969280 CCTCATGGACAAATACGGCAAGG - Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1089745112 11:120611162-120611184 CCTCCTGGACAAATGGGCCAAGG - Intronic
1090234684 11:125138980-125139002 CTTCAAGGGAAAATGGAGCAGGG - Intergenic
1093210571 12:16303323-16303345 CTTCATGGGCAAATGGTGGTAGG + Intergenic
1094494268 12:30979676-30979698 CTTCAAGGCCATATGGGGCATGG - Intronic
1097556886 12:61149671-61149693 CTTGTTGTACAAATGGACCATGG - Intergenic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1101936823 12:109064937-109064959 CTCCCAGGACAAAGGGAGCAGGG - Intronic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103080142 12:118017113-118017135 CTTCTTCGGCAAATGGAGCTGGG - Intronic
1105747536 13:23391894-23391916 CTTCATGTGCACATGGAACATGG + Intronic
1106192050 13:27462171-27462193 CTTCCTGGACACCTGGAGCGTGG + Intergenic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1107464514 13:40637047-40637069 CTTCATTCACAAGTGGAGGAAGG + Intronic
1111029549 13:82577216-82577238 CTTCCTTGATAAATGGAACAAGG - Intergenic
1111581314 13:90227376-90227398 CCTCATGGAGAAATTGAGCAAGG - Intergenic
1112155287 13:96810242-96810264 AGTCCAGGACAAATGGAGCAAGG - Intronic
1112662217 13:101523145-101523167 TTTCAAGGACAAATGGAGCTAGG - Intronic
1114150690 14:20035363-20035385 ATTCATGCAAGAATGGAGCATGG - Intergenic
1120596109 14:86439678-86439700 CCTCATGGACAAAGAAAGCAGGG - Intergenic
1121217588 14:92260562-92260584 CTTCAGGGACAAGTGGACCAAGG + Intergenic
1129199636 15:73991359-73991381 CTTCCTGGAAGAATGGAGCAGGG - Intronic
1130609475 15:85347773-85347795 CCTCATGGAAAAAGGGAGCAGGG + Intergenic
1131959023 15:97768703-97768725 CATCATAGACAGATGGAACAAGG + Intergenic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1134604336 16:15558321-15558343 CTTTATGGAATAAAGGAGCAGGG + Intronic
1136229306 16:28877490-28877512 CCTCGTGGACAGATGCAGCAGGG + Intergenic
1138247846 16:55480312-55480334 CTTAATGGACAAATTGGTCAAGG + Intronic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1143285407 17:5785392-5785414 CTTCTTGCACAAATGGAACCTGG - Intronic
1143353570 17:6307618-6307640 CCCCATGGACAAATGAACCAAGG - Intergenic
1147755264 17:42763164-42763186 CTTCATGGAGGCAGGGAGCAGGG - Intergenic
1149421749 17:56518483-56518505 CTTTATGGAGAAATTAAGCAAGG - Intergenic
1149639703 17:58194816-58194838 CTCCAGGGACAAAAGGGGCATGG + Intronic
1150531330 17:65985520-65985542 CTCCATGAACAAATGGTGCCAGG + Intronic
1157587060 18:48808289-48808311 CCTCATGAACAAATGGGGAAAGG - Intronic
1158305018 18:56095696-56095718 CTTCATGAGCAAAGGGAGAATGG - Intergenic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
926054226 2:9764849-9764871 CTTCAGGAACAAATGAAGCAGGG - Intergenic
927685361 2:25167345-25167367 CTTCATGTTTAAATGGGGCAGGG - Intronic
930542909 2:52730025-52730047 CTTCAAGGAGAAAGGGAGCTAGG + Intergenic
931041612 2:58306744-58306766 CTTCATGCAGAAATGTGGCATGG + Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
933223994 2:79724416-79724438 CTTCATGAACAACAGGAGGATGG + Intronic
937390541 2:121482191-121482213 CTTCCTGAACAGATGTAGCAGGG + Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
938164873 2:129017703-129017725 CCTCATGGACAAAGGAGGCAAGG + Intergenic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
940328489 2:152450874-152450896 GGTAATGGACACATGGAGCAGGG - Intronic
942072899 2:172331316-172331338 CTTCATGGAGAAATTGAGGAGGG + Intergenic
942499336 2:176572298-176572320 CTCCTTGGACAAAAGGAGAATGG - Intergenic
945791921 2:214316004-214316026 CTTCATGAACAAAAGAAGCTAGG - Intronic
945984141 2:216340653-216340675 CTTCATGGACAAAAAGGGAAAGG + Intronic
946067672 2:217003228-217003250 CTGCATGGGCAAATGGCCCAAGG + Intergenic
946475399 2:220001949-220001971 CCTGATGGACAAATGTAGTAGGG - Intergenic
947072948 2:226311313-226311335 ATTCATGGGCAAATGGGGAAAGG - Intergenic
1174481579 20:50834930-50834952 ATGCATGGACAAATGAAGTATGG - Intronic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1178023585 21:28437948-28437970 CTTCAAGAACAAATCGTGCAGGG - Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1180120710 21:45745712-45745734 CTTCACGGAGAAAGGGAGGAAGG + Intronic
1180831525 22:18909406-18909428 CATCATGGCAAAATGGAACATGG - Intronic
1182230859 22:28836592-28836614 CTTCAAGTACAAATGGATCCAGG + Intergenic
1183214820 22:36472768-36472790 GTTCATGGACAAATGTATAATGG - Intronic
1183379289 22:37482900-37482922 CTTCATGGAGAAGCGGACCAGGG - Intronic
1183523165 22:38308389-38308411 GCTCATGGGGAAATGGAGCATGG - Intronic
1183601983 22:38845026-38845048 CCTCATGGAAAATTGGAGCTGGG - Intergenic
1184558726 22:45248693-45248715 TCTCATTGACAGATGGAGCAGGG - Intergenic
1185144092 22:49120136-49120158 CCTGATAGACAAATGGGGCAAGG - Intergenic
1203281609 22_KI270734v1_random:134677-134699 CATCATGGCAAAATGGAACATGG - Intergenic
949358463 3:3206426-3206448 ATTCATGGACAAGGGGAGGAAGG + Intergenic
950794387 3:15498795-15498817 GTTCATGGGCAGCTGGAGCAGGG - Intronic
951642274 3:24849343-24849365 GTTCATGGACAAAGTGAGAATGG + Intergenic
951700013 3:25486782-25486804 CTTCACGGACAATGGGAGAAGGG + Intronic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
953765925 3:45742181-45742203 CTTCTTGGACAAAAGAAGAAGGG - Intronic
953830636 3:46294892-46294914 CTTCATGGACAAGTGGAGACTGG + Intergenic
955079286 3:55642985-55643007 TTTCATGGGCAAATATAGCACGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
959116070 3:102179951-102179973 CTTCATGGTCAAATGAAGCTAGG - Intronic
960358340 3:116679948-116679970 CTTCATGGAGCCATGGAGCCAGG + Intronic
960742096 3:120845661-120845683 TTTCTTGGAAAAATGGACCAGGG - Intergenic
965789461 3:172372281-172372303 CTTCATGGGCACAGGCAGCAGGG + Intronic
966635295 3:182126343-182126365 CCTCATGCAGAAATAGAGCAAGG - Intergenic
970622835 4:17843392-17843414 CTTCATTGAGAAATTGGGCAAGG - Exonic
971767340 4:30850259-30850281 CTTCATGGAATAAAGGAGAATGG + Intronic
975356854 4:73416647-73416669 GTTAATGGGCAAATAGAGCATGG + Intronic
978187296 4:105871757-105871779 CTTCATGGACACAGAGAGCAGGG - Intronic
978834113 4:113127176-113127198 CTTGATGGAAAAGTGAAGCATGG - Intronic
981095307 4:140773256-140773278 CTTCATGGACACTTCGAACATGG - Intergenic
981130390 4:141152243-141152265 CTTCAGGGACAAAAGCAACATGG - Intronic
981769689 4:148294112-148294134 CTCCATGGGCAAAAGGAGCTAGG + Intronic
983323830 4:166227881-166227903 ATACATGGACAACTGGAGCAAGG - Intergenic
986075445 5:4332044-4332066 CTTCAAAGACAAATTGAGCCTGG - Intergenic
987061159 5:14245439-14245461 CTTCATCTACAAGTGGAGGAGGG - Intronic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988249336 5:28735008-28735030 CTTCATGGGAAAATGAAGCAGGG - Intergenic
990336036 5:54773773-54773795 ATTCATAGAAAAATGGAGTAAGG - Intergenic
995261143 5:110105932-110105954 CTGCATTGAGAAATGGACCACGG - Intergenic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1003447807 6:6200675-6200697 GTTCATGGAGGAATGGAGGAAGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1004643706 6:17539614-17539636 CTGCATGGACATAAGGAACATGG - Intronic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1008960498 6:57261270-57261292 CTTAAGGGACAAAAGGAGCCAGG + Intergenic
1010680101 6:78789065-78789087 ATTCATGGAAAGCTGGAGCAAGG - Intergenic
1013468821 6:110442478-110442500 CATCATGGCCAAGTGGAACAGGG - Exonic
1014228679 6:118877369-118877391 CCTAATGGAAAAATGGAGAATGG + Intronic
1014503408 6:122222786-122222808 ACTGATGGAAAAATGGAGCAAGG - Intergenic
1015800064 6:137051762-137051784 TTTAATGAACAAATGGAGGATGG + Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017731536 6:157321574-157321596 CTTCATGGACCCAAGGATCAAGG + Intronic
1019001340 6:168755514-168755536 CGACATAGACAAATGGGGCAGGG - Intergenic
1022604534 7:31797140-31797162 TTTCATGGACAAATGGCTAAGGG + Intronic
1022970285 7:35510794-35510816 CTTGATGGACAGATGTGGCAAGG + Intergenic
1023196392 7:37644137-37644159 CTTCATGGACCCATGGACCTGGG - Intergenic
1024520292 7:50299720-50299742 CTTCATGGACAAAAGGAGGGAGG - Intergenic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1027125502 7:75554066-75554088 GTTCATGGACCAGGGGAGCAGGG - Intronic
1032601454 7:133300503-133300525 CTTCATGTACAAATGGTGGTCGG - Intronic
1037507013 8:19540756-19540778 CTTCCTGGGCAAAGGGAGCAGGG - Intronic
1037662874 8:20942175-20942197 ATGCATGGAGAAAAGGAGCAAGG + Intergenic
1038478397 8:27884968-27884990 CATCTTGGACAAGTGGAGGAGGG + Intronic
1038856885 8:31343790-31343812 CTTCATGGACACAGGCAGGATGG + Intergenic
1039573117 8:38602689-38602711 CTTTATAGAGAACTGGAGCAGGG + Intergenic
1040505534 8:48044596-48044618 CTTCAGGAAAAAATAGAGCAAGG - Intronic
1040894913 8:52355842-52355864 CTCCCTGCACAAATGGAACAGGG + Intronic
1041014442 8:53578231-53578253 CTTAATGGAATAATGAAGCAAGG + Intergenic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041794642 8:61734049-61734071 ATTCATGGAACAAAGGAGCAGGG + Intergenic
1041958541 8:63584402-63584424 GTTCATGGATAAATGAGGCAGGG - Intergenic
1044824545 8:96183768-96183790 CTTCATGGAGGAAGGGAGCCTGG - Intergenic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047287277 8:123498387-123498409 ATTTTTGGCCAAATGGAGCAGGG + Exonic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1058483366 9:105419281-105419303 CTTCAAGTACAAATACAGCAGGG - Intronic
1058654667 9:107208860-107208882 CATCATGGACAAGTGGCCCATGG + Intergenic
1058837481 9:108871420-108871442 CTTCAGGGACAAATCGACAATGG + Intronic
1059661332 9:116404763-116404785 GTTCATAGAAAAATTGAGCAGGG + Intergenic
1186884750 X:13902282-13902304 CTTTATTGACAAATTGAGCGAGG - Intronic
1192798614 X:74444946-74444968 TTCCATGGACAAATGTAGCTGGG + Intronic
1197885135 X:131210391-131210413 CTTCCTGGAAAAATGAAGTAAGG - Intergenic
1197971147 X:132116412-132116434 TTTCATGTACAAATGGAAAATGG - Intronic
1198254624 X:134914576-134914598 CTTCTTGGAAAAATGGGGTAGGG - Intronic
1198880936 X:141280390-141280412 CATCATGGAAAAATGGAATAAGG + Intergenic
1199955672 X:152740515-152740537 CTTCATAGAGAAATGGGGCAGGG - Intergenic
1202380604 Y:24273908-24273930 CCTCATGGAAAAAGGGAGCAGGG + Intergenic
1202490180 Y:25396217-25396239 CCTCATGGAAAAAGGGAGCAGGG - Intergenic