ID: 1176917247

View in Genome Browser
Species Human (GRCh38)
Location 21:14640962-14640984
Sequence TCGACTAGTTGGCCATGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176917247 Original CRISPR TCGACTAGTTGGCCATGAAA TGG Intronic
917733348 1:177898176-177898198 TCAACTAGATGGCCATGCATCGG - Intergenic
1063505079 10:6590521-6590543 AAGACTACTTGGCCATAAAAAGG + Intergenic
1063821258 10:9839080-9839102 AATACTACTTGGCCATGAAAAGG + Intergenic
1071864999 10:89719540-89719562 TAGACTATTTTCCCATGAAATGG - Exonic
1085338129 11:75712993-75713015 TCGAGTAGGTCCCCATGAAAAGG + Intergenic
1085849643 11:80104998-80105020 TCCACTAGTTGGTCTTGACATGG - Intergenic
1090542280 11:127721168-127721190 CAGACAAGTTGGCAATGAAATGG + Intergenic
1090907217 11:131086927-131086949 TTGACTAGTAGGCCATCAAGTGG + Intergenic
1095727169 12:45466516-45466538 TATACCAGTTGGCCATGAATAGG - Intergenic
1095920063 12:47520215-47520237 AGTACTATTTGGCCATGAAAAGG - Intergenic
1098293341 12:68980031-68980053 TAGACTGCGTGGCCATGAAATGG - Intergenic
1108468999 13:50749224-50749246 ACTACTACTTGGCCATAAAAAGG - Intronic
1131650734 15:94396051-94396073 TGCACTATTTGGCCATGAAAAGG + Intronic
1148207161 17:45785989-45786011 TCGAGTAGTTGGCACTGAATGGG + Intronic
1152345842 17:79751109-79751131 AATACTATTTGGCCATGAAAAGG + Intergenic
1165484031 19:36084528-36084550 TAGAGTATTTGGCCATGATAAGG + Intronic
926529301 2:14022486-14022508 TAGACTCCTTGTCCATGAAATGG - Intergenic
927332980 2:21887925-21887947 TCCACTAGGTGGACACGAAATGG + Intergenic
930428802 2:51247435-51247457 TCCTCTAGATGGCGATGAAAGGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
935220971 2:101012348-101012370 TGGAATATTTGGCCATTAAAAGG + Intronic
937433770 2:121863268-121863290 AGTACTATTTGGCCATGAAAAGG - Intergenic
939652621 2:144783823-144783845 TCGACTTCTTGGTCCTGAAATGG - Intergenic
939675889 2:145071605-145071627 GTGGCTAGTTGGCCAGGAAATGG - Intergenic
947655360 2:231822067-231822089 ACTACTACTTGGCAATGAAAAGG - Intergenic
948510718 2:238462639-238462661 AATACTATTTGGCCATGAAAAGG - Intergenic
1176917247 21:14640962-14640984 TCGACTAGTTGGCCATGAAATGG + Intronic
954841287 3:53514249-53514271 TCAAGTACTAGGCCATGAAAGGG + Intronic
960938317 3:122917018-122917040 TCCACTAGTAGGACTTGAAAGGG + Intronic
975869365 4:78761451-78761473 TGTACTATATGGCCATGAAAAGG + Intergenic
979441373 4:120753884-120753906 TCGAATAGTGAGCTATGAAATGG + Intronic
982624712 4:157752158-157752180 TCGACCAGATGGACAGGAAATGG + Intergenic
986389588 5:7272181-7272203 TCTCCTAGTTTGCCATGAAATGG - Intergenic
989200586 5:38758883-38758905 TTGACTTTTTGGCCATGCAAAGG + Intergenic
989472589 5:41837663-41837685 TCTAATAGTTAGCAATGAAATGG + Intronic
992969412 5:82040820-82040842 GGGACTTGTTGGCCATGACAAGG - Intronic
993754990 5:91717531-91717553 ACCACTACTTGGCCATAAAAAGG + Intergenic
996487714 5:124056442-124056464 CCGAGTTGTTGGCCATGACAGGG - Intergenic
1015860395 6:137672592-137672614 TCAACTAGTTGGACATTAAATGG - Intergenic
1016499021 6:144697439-144697461 TCGACCTGTTGCCCAAGAAAAGG + Intronic
1016842618 6:148539539-148539561 AGTACTACTTGGCCATGAAAAGG - Intronic
1033611455 7:142967153-142967175 TGGACTAGGTAGCCCTGAAATGG - Intergenic
1044180499 8:89187824-89187846 TGGATTAGTGTGCCATGAAAAGG + Intergenic
1048808190 8:138260564-138260586 TCTAAGATTTGGCCATGAAATGG - Intronic
1053195164 9:36111867-36111889 TCAACTAGTTGGCAATAAAAAGG + Intronic
1185521882 X:746589-746611 AAGACTAGTTTTCCATGAAATGG - Intergenic
1192895044 X:75433615-75433637 TACACTACTTGGCCATAAAAAGG - Intronic
1198160922 X:134007366-134007388 TCGTCTACTTGGGCGTGAAAGGG - Intergenic
1198734095 X:139767304-139767326 TGGACTAGTTGGGCAGTAAAAGG + Intronic
1201196045 Y:11495531-11495553 TCGAATAGTATGGCATGAAAGGG + Intergenic
1201610325 Y:15835679-15835701 TATATTATTTGGCCATGAAAAGG + Intergenic