ID: 1176918049

View in Genome Browser
Species Human (GRCh38)
Location 21:14649524-14649546
Sequence CTTTGAAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176918049 Original CRISPR CTTTGAAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr