ID: 1176922808

View in Genome Browser
Species Human (GRCh38)
Location 21:14708772-14708794
Sequence CAAGGCAAGGAGAAGGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176922808_1176922813 -6 Left 1176922808 21:14708772-14708794 CCAGTCACCTTCTCCTTGCCTTG No data
Right 1176922813 21:14708789-14708811 GCCTTGTGGGAAGTCACAGAAGG No data
1176922808_1176922815 15 Left 1176922808 21:14708772-14708794 CCAGTCACCTTCTCCTTGCCTTG No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176922808 Original CRISPR CAAGGCAAGGAGAAGGTGAC TGG (reversed) Intergenic
No off target data available for this crispr