ID: 1176922813

View in Genome Browser
Species Human (GRCh38)
Location 21:14708789-14708811
Sequence GCCTTGTGGGAAGTCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176922808_1176922813 -6 Left 1176922808 21:14708772-14708794 CCAGTCACCTTCTCCTTGCCTTG No data
Right 1176922813 21:14708789-14708811 GCCTTGTGGGAAGTCACAGAAGG No data
1176922807_1176922813 -5 Left 1176922807 21:14708771-14708793 CCCAGTCACCTTCTCCTTGCCTT No data
Right 1176922813 21:14708789-14708811 GCCTTGTGGGAAGTCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176922813 Original CRISPR GCCTTGTGGGAAGTCACAGA AGG Intergenic
No off target data available for this crispr