ID: 1176922815

View in Genome Browser
Species Human (GRCh38)
Location 21:14708810-14708832
Sequence GGATGTCAAATATTATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176922814_1176922815 -3 Left 1176922814 21:14708790-14708812 CCTTGTGGGAAGTCACAGAAGGA No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data
1176922811_1176922815 8 Left 1176922811 21:14708779-14708801 CCTTCTCCTTGCCTTGTGGGAAG No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data
1176922812_1176922815 2 Left 1176922812 21:14708785-14708807 CCTTGCCTTGTGGGAAGTCACAG No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data
1176922808_1176922815 15 Left 1176922808 21:14708772-14708794 CCAGTCACCTTCTCCTTGCCTTG No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data
1176922807_1176922815 16 Left 1176922807 21:14708771-14708793 CCCAGTCACCTTCTCCTTGCCTT No data
Right 1176922815 21:14708810-14708832 GGATGTCAAATATTATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176922815 Original CRISPR GGATGTCAAATATTATCACA TGG Intergenic
No off target data available for this crispr