ID: 1176927350

View in Genome Browser
Species Human (GRCh38)
Location 21:14766317-14766339
Sequence TCTCCATGTTGTCACATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176927348_1176927350 6 Left 1176927348 21:14766288-14766310 CCTGAAGACTTACTGTAGAGAAA No data
Right 1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG No data
1176927346_1176927350 25 Left 1176927346 21:14766269-14766291 CCATTACACGCTTTTTCCTCCTG No data
Right 1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG No data
1176927345_1176927350 28 Left 1176927345 21:14766266-14766288 CCACCATTACACGCTTTTTCCTC No data
Right 1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG No data
1176927347_1176927350 9 Left 1176927347 21:14766285-14766307 CCTCCTGAAGACTTACTGTAGAG No data
Right 1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176927350 Original CRISPR TCTCCATGTTGTCACATTAA TGG Intergenic