ID: 1176933231

View in Genome Browser
Species Human (GRCh38)
Location 21:14838909-14838931
Sequence CTGTAAGACCAGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176933226_1176933231 -8 Left 1176933226 21:14838894-14838916 CCCTTTCCTCTCTGACTGTAAGA No data
Right 1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG No data
1176933227_1176933231 -9 Left 1176933227 21:14838895-14838917 CCTTTCCTCTCTGACTGTAAGAC No data
Right 1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176933231 Original CRISPR CTGTAAGACCAGAAGGAAGG TGG Intergenic
No off target data available for this crispr