ID: 1176935492

View in Genome Browser
Species Human (GRCh38)
Location 21:14861727-14861749
Sequence TACCCAAGACTGGTAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176935489_1176935492 21 Left 1176935489 21:14861683-14861705 CCAATTTACTGTATTAGTCCATT 0: 554
1: 1022
2: 1680
3: 1722
4: 1460
Right 1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG No data
1176935490_1176935492 3 Left 1176935490 21:14861701-14861723 CCATTTTCACACTGCTGATAAAG 0: 948
1: 1384
2: 2619
3: 2041
4: 1974
Right 1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176935492 Original CRISPR TACCCAAGACTGGTAAGAAA AGG Intergenic
No off target data available for this crispr