ID: 1176936198 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:14870049-14870071 |
| Sequence | CTGCTATTGCAGATGGAACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176936198_1176936204 | 27 | Left | 1176936198 | 21:14870049-14870071 | CCCAGTTCCATCTGCAATAGCAG | No data | ||
| Right | 1176936204 | 21:14870099-14870121 | TACTGAAACTTGAAAGAAAAGGG | No data | ||||
| 1176936198_1176936203 | 26 | Left | 1176936198 | 21:14870049-14870071 | CCCAGTTCCATCTGCAATAGCAG | No data | ||
| Right | 1176936203 | 21:14870098-14870120 | ATACTGAAACTTGAAAGAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176936198 | Original CRISPR | CTGCTATTGCAGATGGAACT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||