ID: 1176936198

View in Genome Browser
Species Human (GRCh38)
Location 21:14870049-14870071
Sequence CTGCTATTGCAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176936198_1176936204 27 Left 1176936198 21:14870049-14870071 CCCAGTTCCATCTGCAATAGCAG No data
Right 1176936204 21:14870099-14870121 TACTGAAACTTGAAAGAAAAGGG No data
1176936198_1176936203 26 Left 1176936198 21:14870049-14870071 CCCAGTTCCATCTGCAATAGCAG No data
Right 1176936203 21:14870098-14870120 ATACTGAAACTTGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176936198 Original CRISPR CTGCTATTGCAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr