ID: 1176937267

View in Genome Browser
Species Human (GRCh38)
Location 21:14881931-14881953
Sequence AAACCAGCCTTCCCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176937267_1176937273 22 Left 1176937267 21:14881931-14881953 CCATGTCTAGGGAAGGCTGGTTT 0: 1
1: 0
2: 3
3: 12
4: 150
Right 1176937273 21:14881976-14881998 CTCTCTGTATACTCACATGGTGG No data
1176937267_1176937274 26 Left 1176937267 21:14881931-14881953 CCATGTCTAGGGAAGGCTGGTTT 0: 1
1: 0
2: 3
3: 12
4: 150
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data
1176937267_1176937272 19 Left 1176937267 21:14881931-14881953 CCATGTCTAGGGAAGGCTGGTTT 0: 1
1: 0
2: 3
3: 12
4: 150
Right 1176937272 21:14881973-14881995 CTTCTCTCTGTATACTCACATGG No data
1176937267_1176937275 27 Left 1176937267 21:14881931-14881953 CCATGTCTAGGGAAGGCTGGTTT 0: 1
1: 0
2: 3
3: 12
4: 150
Right 1176937275 21:14881981-14882003 TGTATACTCACATGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176937267 Original CRISPR AAACCAGCCTTCCCTAGACA TGG (reversed) Intergenic
904396441 1:30225374-30225396 AAACCACATCTCCCTAGACAGGG - Intergenic
909232235 1:73105579-73105601 ACAACAGCCTCCCCCAGACATGG + Intergenic
909299617 1:73995736-73995758 ACACCTTCCTCCCCTAGACAGGG + Intergenic
909743174 1:79058163-79058185 GAAACAGCCTTTCCCAGACAAGG + Intergenic
911256458 1:95638814-95638836 ACACCAGTCATCCCTAGACATGG - Intergenic
915243706 1:154541725-154541747 CCAGCAGCCTTCCCCAGACAGGG - Intronic
916013810 1:160730453-160730475 AAACCAGCCTGACCAACACAGGG + Intergenic
916809352 1:168291915-168291937 AAACAAACCTTCCTTAAACAAGG + Intronic
917292941 1:173490045-173490067 AAACCAGCATTCCCCAGAATTGG - Intergenic
918612911 1:186512651-186512673 AAAACATCCTCCCCTAGCCAAGG - Intergenic
919154895 1:193751230-193751252 AAAGTATCCTTCCCTACACAGGG - Intergenic
920392957 1:205622011-205622033 AGACCAGCCTCCCGTAGAGATGG + Intronic
921260116 1:213378918-213378940 AGGCCAGGCTACCCTAGACAGGG + Intergenic
922490547 1:226013233-226013255 AAACCAGCCTTGGCTGGGCATGG + Intergenic
922793301 1:228322625-228322647 AAGTCAGCCCTCCCTATACAGGG + Intronic
924692614 1:246365930-246365952 AACCCTGCCTTCCCTAGACCTGG + Intronic
1067065975 10:43104586-43104608 AAGCCACCCTTCCCCACACAAGG + Intronic
1067453432 10:46396745-46396767 AAATCAGCATTCCCTTGGCAAGG + Intergenic
1067583802 10:47463021-47463043 AAATCAGCATTCCCTTGGCAAGG - Intronic
1067633806 10:47988369-47988391 AAATCAGCATTCCCTTGGCAAGG - Intergenic
1067829475 10:49602105-49602127 ACATCAGACTTGCCTAGACACGG + Intergenic
1068401288 10:56530979-56531001 AAAACAGCCTTGTGTAGACAGGG + Intergenic
1068790808 10:61029216-61029238 AATCAAGCCCTCGCTAGACATGG - Intergenic
1069725985 10:70579180-70579202 AAGCAAGCCTTCCCTACCCAAGG + Intergenic
1072331913 10:94362716-94362738 AAACCACCGCCCCCTAGACACGG + Intronic
1075280218 10:121132523-121132545 AATCCAGCCTGCCCTAGAATGGG + Intergenic
1075383682 10:122039321-122039343 AAATCAGCCTCCCCTTGAGAGGG + Intronic
1078999896 11:16742941-16742963 AAATCAGCCTTCCATATACTTGG + Intronic
1079242693 11:18731902-18731924 ATTACAGCCTTCCCTAAACATGG + Intronic
1084708420 11:70829431-70829453 GAAGGAGCCTTCCCAAGACAAGG + Intronic
1085955515 11:81388899-81388921 AAATCAGCCTTCTGTATACACGG - Intergenic
1089236156 11:117027760-117027782 AAAACAGCCTTCCCTGGGCCGGG - Intronic
1089599275 11:119603537-119603559 ACAACAGCCCTCCCTGGACATGG - Intergenic
1093095667 12:14969421-14969443 AAATCAGCCATCACTAGACTAGG + Intergenic
1095924875 12:47568504-47568526 AAACGGGCCTTCACCAGACATGG - Intergenic
1097624197 12:61980123-61980145 AAACCAGCCTTGCATGGCCAGGG - Intronic
1097805327 12:63958788-63958810 AAATCAGCCTTCCGTTGACAAGG - Intronic
1102221770 12:111199603-111199625 AGACCGGCCTGCCCTAGACCAGG - Intronic
1102500457 12:113348779-113348801 AAACCAGAGTCCCCCAGACAAGG - Intronic
1106715624 13:32384999-32385021 AACCCAGACTTACCTGGACAAGG + Intronic
1107275230 13:38670649-38670671 AAAACAGCATTCTCTATACAAGG + Intergenic
1110360934 13:74624857-74624879 AAGTGAGCCTTCCCTAGACATGG - Intergenic
1111183992 13:84705268-84705290 AAAGCAGCCTTCTCTAATCAAGG + Intergenic
1111903332 13:94226927-94226949 GAACCAGCAGTCCCAAGACATGG + Intronic
1113695382 13:112342413-112342435 AGAGAAGCCTTCCCCAGACACGG - Intergenic
1114600472 14:23952112-23952134 GAGTCAGCCTTCCCTGGACATGG + Intergenic
1115112122 14:29836689-29836711 AAAGCAGCCTCCCCTAGAGAGGG + Intronic
1117643098 14:57821657-57821679 TAACCAACCTTCCCCAGCCATGG - Intronic
1117644543 14:57837716-57837738 AAGCCAATCTTCCCTAGAAAGGG + Intronic
1122054911 14:99089241-99089263 ACACTAGACTTCCCTAGAGAGGG + Intergenic
1122703568 14:103606323-103606345 AAACCAGCCTGGGCAAGACAGGG + Intronic
1125681512 15:41533628-41533650 AAACCAGCCTGGCCAATACAGGG + Intronic
1125966764 15:43881065-43881087 AAACCAGCATTCCCAAAAGAGGG - Intronic
1128745503 15:70111479-70111501 CAGCCAGCCTTCCCTGGGCAGGG + Intergenic
1128795555 15:70463854-70463876 CCACCAGCCTTCCTCAGACATGG + Intergenic
1129044054 15:72717618-72717640 TAACCAGCCTTCCTTATAGAAGG - Intronic
1129331993 15:74832500-74832522 CAACCAGCCTTGCTTTGACAGGG - Intergenic
1130317444 15:82808929-82808951 AAACAGGCCTTCCGTAGCCAGGG + Intergenic
1130659701 15:85821117-85821139 AGACCAGCCTGGCCAAGACAGGG - Intergenic
1133193844 16:4154296-4154318 AAACCAGCCTGGCCAAAACATGG + Intergenic
1133287456 16:4697249-4697271 AAACCCGCTTTCCCTGGAAAGGG + Intronic
1135112969 16:19704992-19705014 TCACCAGCCTTCCCATGACAGGG + Exonic
1136047871 16:27629595-27629617 AACCCAGCCTAGCATAGACACGG + Intronic
1137373066 16:47926732-47926754 GAACCAGCCTCCCCTAGACAGGG + Intergenic
1138643928 16:58408792-58408814 AAATCTGCCTTCACTAGATAAGG - Intergenic
1139222259 16:65195561-65195583 AAAGCACACTTCCCTAGACCTGG - Intergenic
1139321171 16:66115526-66115548 AAAACAGCGTTCCTTAGGCATGG - Intergenic
1140828122 16:78726430-78726452 AAACCAGCCTGGCCAACACAGGG - Intronic
1141378332 16:83552113-83552135 CACTCAGCCTTCCCTGGACAGGG - Intronic
1142110533 16:88328763-88328785 GAAGCAGCCCTCCCTAGACTGGG - Intergenic
1142471020 17:163343-163365 AGTCCTGCCTTCCCTAGAGAAGG + Intronic
1147365648 17:39957428-39957450 CATCCTGCCTTCCCTAGCCATGG - Intergenic
1147551001 17:41441384-41441406 CAACCAGCCTTCCCTATCCAGGG + Intergenic
1148451838 17:47783617-47783639 AGACCATCCTTCCAGAGACAGGG - Intergenic
1149720793 17:58842038-58842060 AGACCAGCCTACCCAACACAGGG - Intronic
1151453035 17:74211036-74211058 AAGGCGGCCTTCTCTAGACAAGG - Intergenic
1153280886 18:3412800-3412822 AAAACAGACTTACCTAGCCAGGG + Intronic
1155180308 18:23339726-23339748 ACAGCAGCCTTCACCAGACACGG - Intronic
1158939460 18:62393549-62393571 GAACCAGCCTTCCCAAGAGCAGG + Intergenic
1161267685 19:3372388-3372410 GTACCAGCCTTCCTTACACATGG + Intronic
1162506970 19:11091165-11091187 GAACCAGCCTAGCCTAGAAAAGG + Intronic
1163788958 19:19294695-19294717 AATCCAGCCCTCCCTAGAAATGG - Intronic
1165119040 19:33547272-33547294 AGGCCAGCCTGCCCTGGACAGGG - Intergenic
1168355191 19:55695908-55695930 AACCCAGCCATCCCTTGACCTGG - Intronic
925043352 2:751349-751371 AAACCATCCTCCCTCAGACATGG + Intergenic
925478669 2:4246894-4246916 AAACCAGCCCCCCCTCGCCAAGG - Intergenic
925821739 2:7805455-7805477 AAACCTGCCTTCTCTAGAGTCGG - Intergenic
926096129 2:10081298-10081320 ATTCCAGCCTTTCCAAGACAGGG + Intergenic
931145413 2:59511848-59511870 AGACCAGCCAGCCCTAGACAAGG + Intergenic
935923402 2:108039929-108039951 AGACAAGCCATCCCTAGAAATGG - Intergenic
936580425 2:113695523-113695545 AAACCAGCCTGACCAACACAGGG + Intergenic
938901993 2:135806186-135806208 AAACCAGCCTGGGCAAGACATGG - Intronic
944465449 2:199995862-199995884 AAAACATCCTTACCAAGACAGGG + Intronic
946404228 2:219484084-219484106 ACCCCAGCCTGCCCAAGACAAGG + Exonic
947503859 2:230692019-230692041 ACCACAGCCGTCCCTAGACAAGG + Intergenic
1170525573 20:17232923-17232945 TAACCTTGCTTCCCTAGACATGG + Intronic
1170555577 20:17512424-17512446 AAACCAGCCCTCACCAGACATGG + Intronic
1170735955 20:19014454-19014476 CACCGAGCCTTACCTAGACATGG - Intergenic
1172591467 20:36121159-36121181 AAAGCAGCCCTCAGTAGACACGG + Intronic
1172875506 20:38161658-38161680 GCACCTGCCCTCCCTAGACATGG + Intronic
1173088105 20:39944019-39944041 AAACCAGACTCCTCTAGGCAAGG + Intergenic
1175362561 20:58425067-58425089 TAACCAGCATTACCTAAACAAGG - Intronic
1175664147 20:60843885-60843907 AAACAAGCCCACCCTAGGCAGGG - Intergenic
1175964423 20:62653342-62653364 AAACAAGCCTTGCCTGGACCTGG + Intronic
1176937267 21:14881931-14881953 AAACCAGCCTTCCCTAGACATGG - Intergenic
1177784134 21:25652052-25652074 AAAATAGCCTTCCCTAAAAATGG + Intronic
1180643495 22:17318544-17318566 TAAACAGCCTTCCCTAGAGGTGG + Intergenic
1182100631 22:27655140-27655162 AGGCCAGCCTTCCCTTGAGAAGG + Intergenic
952873820 3:37925176-37925198 AAACAAGGCTTCCCTGGGCAGGG - Intronic
956395568 3:68822668-68822690 AAACCAGCCTCCCTGAAACATGG - Intronic
959559341 3:107761625-107761647 CAACCAGCCTTCCCGAAGCAGGG - Intronic
962370943 3:134820259-134820281 AAACCTGCTTTTCCCAGACATGG - Intronic
962711304 3:138088660-138088682 AAATCAGCATTCCCTTCACAAGG + Intronic
964440223 3:156700895-156700917 ACACCAGCCTTCTCTAGAGAGGG - Intronic
964713520 3:159696970-159696992 AAATCTGGCTTCCTTAGACAAGG - Intronic
970122700 4:12774743-12774765 TAACCAGCCTTTACTAGAAATGG - Intergenic
977905727 4:102475732-102475754 AAACCAGCCTACCCTAAGGAGGG - Intergenic
982639473 4:157939759-157939781 AAATCTGCCTTCCCTAAACTTGG + Intergenic
983935359 4:173499243-173499265 AACCCAGCCTGCACTAGGCATGG + Intergenic
986188872 5:5474690-5474712 AAACCAGCCTTTCTCAGCCAGGG - Intronic
990613830 5:57487017-57487039 AAACCAGCTTTCACTCCACAGGG + Intergenic
992662043 5:78971352-78971374 ACACCAGCCTTCCCCAGCCCTGG + Intronic
1000512809 5:162204635-162204657 GAACCACCCTTCTCCAGACAGGG + Intergenic
1001372891 5:171224105-171224127 AACCCAGCCTTCTTTGGACAGGG + Intronic
1001921321 5:175602186-175602208 AAACATGCATTGCCTAGACAGGG + Intergenic
1008963968 6:57295843-57295865 AAACCATCCTTCCCAACACCCGG + Intergenic
1010874744 6:81088471-81088493 AAGCCAGACTTACTTAGACATGG + Intergenic
1011171820 6:84513233-84513255 AAGCAGGCCTTCACTAGACATGG + Intergenic
1013496572 6:110703639-110703661 AAACCAGCCTTGACAACACAGGG + Intronic
1018219021 6:161560282-161560304 AAAGCAGCCTTCACTTGAAAAGG - Intronic
1018994639 6:168701609-168701631 AAACCAGCCTTTGCTAGAACAGG + Intergenic
1021599598 7:22352000-22352022 TAACCACCCTTCACTAGCCAGGG - Intronic
1023534525 7:41194291-41194313 AAACCTGCCTGACCAAGACATGG + Intergenic
1023537158 7:41225631-41225653 ACATCAGCCTCCCCTAGGCAGGG - Intergenic
1029670807 7:102029429-102029451 AACCCAGCCTTCCATATATAAGG - Intronic
1034398717 7:150847299-150847321 AAACCCACCTTCCCTAATCAGGG + Intronic
1034782338 7:153891986-153892008 ACTCCAGCTTTCCCTATACAGGG - Intronic
1038014091 8:23498579-23498601 CCACCCGCCTTCCCTAGGCATGG + Intergenic
1038269968 8:26067145-26067167 AAAGGAGCCCTCACTAGACACGG + Intergenic
1043225222 8:77719060-77719082 TAACCAACCTTCCCTATACATGG + Intergenic
1044905814 8:97001304-97001326 AAATCAGATTTCACTAGACAAGG - Intronic
1045844178 8:106614159-106614181 AAACAAGCCTTTCCAAGACTTGG - Intronic
1049305475 8:141900545-141900567 ACATCAGCCCTCCCCAGACACGG - Intergenic
1049927121 9:420225-420247 AGCCCTGCCTTCCCTAGGCAGGG - Intronic
1051069093 9:13140978-13141000 ACACCAGCTTTCCCTTGCCAAGG + Intronic
1051811745 9:21057121-21057143 AAGCCAGCCCTCACCAGACACGG + Intergenic
1052860796 9:33436645-33436667 AAACGAGCCTTTCCCAGCCACGG - Intergenic
1053729230 9:41035651-41035673 AAACCAGCCTCCCCTAGCCATGG + Intergenic
1054699283 9:68396415-68396437 AAACCAGCCTCCCCTAGCCATGG - Intronic
1054744083 9:68836769-68836791 AAGACAGCCTTCCCTTGACCAGG - Intronic
1055299986 9:74872666-74872688 AAATCAGCCTGGCCAAGACAGGG - Intronic
1058633217 9:107010306-107010328 TAACCAAGCTTCCCGAGACATGG + Intronic
1059947051 9:119420128-119420150 AAAACAGTCTTCCCTAGAGTTGG - Intergenic
1061189289 9:129072245-129072267 GATCCAGCCATCCCTAGGCAGGG + Intergenic
1185703336 X:2248097-2248119 AGACCAGCCTGCCCAACACAGGG + Intronic
1186767849 X:12790248-12790270 CAACCAGCCCTCTATAGACAGGG + Intergenic
1187306925 X:18104083-18104105 AAAACAGCCTTTCCAACACATGG + Intergenic
1192624115 X:72710291-72710313 AAGTCAGCCTTCCATATACATGG - Intronic
1196789232 X:119449213-119449235 AGACCAGCCTGCCCAACACAGGG + Intronic
1197964978 X:132050516-132050538 AAGTCAGCCTTCCCTATACATGG + Intergenic
1199157420 X:144566940-144566962 AAACATGCCTACTCTAGACAGGG + Intergenic
1199517967 X:148700257-148700279 AAACCAGCCTTCCCTGCAACAGG + Intronic
1199710570 X:150466287-150466309 ACACCAGCCAACCCTAAACAAGG - Intronic
1199927218 X:152480319-152480341 ACAACAGCCCTCCCTGGACATGG + Intergenic
1199938335 X:152599649-152599671 AAAACATCCTTCCTGAGACATGG + Intergenic
1200056627 X:153464836-153464858 ACCCCACCCTTCCCTAGGCATGG - Intronic