ID: 1176937269

View in Genome Browser
Species Human (GRCh38)
Location 21:14881954-14881976
Sequence GAAGGTATGATCCATGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176937269_1176937277 11 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937277 21:14881988-14882010 TCACATGGTGGAAGGGCCAAGGG No data
1176937269_1176937273 -1 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937273 21:14881976-14881998 CTCTCTGTATACTCACATGGTGG No data
1176937269_1176937278 23 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937278 21:14882000-14882022 AGGGCCAAGGGATCTCTCTCAGG No data
1176937269_1176937275 4 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937275 21:14881981-14882003 TGTATACTCACATGGTGGAAGGG No data
1176937269_1176937276 10 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG No data
1176937269_1176937274 3 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data
1176937269_1176937272 -4 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937272 21:14881973-14881995 CTTCTCTCTGTATACTCACATGG No data
1176937269_1176937279 24 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937279 21:14882001-14882023 GGGCCAAGGGATCTCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176937269 Original CRISPR GAAGGTATGATCCATGGATC AGG (reversed) Intergenic
900900827 1:5514476-5514498 GAATGTATGTTCCATGGAGACGG + Intergenic
902126255 1:14214193-14214215 GAAGAAATGATCCAAGGACCCGG + Intergenic
903369340 1:22825245-22825267 GAAGATCTAATCCATGGATGGGG + Intronic
905839355 1:41161985-41162007 GAATGCATGCTCCATGGAGCCGG + Intronic
906575558 1:46886334-46886356 GCACGTTTGATCCAGGGATCTGG + Intergenic
906596418 1:47081562-47081584 GCACGTTTGATCCAGGGATCTGG - Intronic
906918617 1:50038914-50038936 GAAGTTATGCTCCCTGTATCTGG + Intergenic
907982653 1:59499215-59499237 GAAGGTATTTTCCATGGACAAGG - Intronic
909253116 1:73383287-73383309 AAAGGAATGATGCATGGACCAGG + Intergenic
912647910 1:111412596-111412618 CAAGGTATTCTCCATGGATCTGG + Intergenic
915631663 1:157157418-157157440 GAATTGATGGTCCATGGATCAGG - Intergenic
917919050 1:179734558-179734580 GAAGGAATCATCCATGAATCAGG - Intergenic
918217198 1:182402247-182402269 GAAAGTATCACCCATGGATAAGG - Intergenic
918677097 1:187300692-187300714 GAAGGTATGATCCATTCCTTAGG + Intergenic
918847687 1:189639711-189639733 GAAGGTATGTCCCATGGATAAGG - Intergenic
918914239 1:190614978-190615000 GAATGTATGCTCCATGAATGTGG + Intergenic
921116233 1:212093865-212093887 GAAGGTGTGATCCCTGGCTAGGG - Intronic
923003132 1:230024000-230024022 GAAGGTACCATCCATGAACCGGG - Intergenic
924076176 1:240339471-240339493 GAAGGTATTCTCCATGGATAAGG + Intronic
924486507 1:244488747-244488769 GAAGGTATCAGCCCTGGAGCCGG + Intronic
1065455839 10:25905850-25905872 GAATGTATCCTCCATGGATAAGG + Intergenic
1065642981 10:27804008-27804030 GGAGTGATGATCCATGGATGAGG - Intergenic
1068694874 10:59956786-59956808 GAAAGTATGATCCACAGATCTGG - Exonic
1073529919 10:104221499-104221521 GAAATTATCATCCATGAATCAGG + Intronic
1079957769 11:26885180-26885202 GAATGTATATTCCATGGATTTGG - Intergenic
1080718656 11:34827978-34828000 GAAGGTTTGATTCATAGGTCTGG - Intergenic
1081794936 11:45812540-45812562 GAAGGCACCATCTATGGATCGGG - Exonic
1086204957 11:84246775-84246797 GAATGTGTCATCCATGGATAAGG + Intronic
1087241403 11:95785294-95785316 GAAGGTATCTCCCATGGATAAGG + Intronic
1088037924 11:105340315-105340337 GAAGGTGTGACCAATGGTTCTGG - Intergenic
1089309032 11:117545727-117545749 GAAGGCATCATCCAGGGATGAGG + Intronic
1090671075 11:128945745-128945767 GGAAGTAGGATCCATGGACCTGG + Intergenic
1095450720 12:42327810-42327832 GAAGGTATGCTGCAGAGATCAGG + Intronic
1096225699 12:49865585-49865607 AAAGGGAAGATCCCTGGATCAGG - Intergenic
1096636402 12:52962741-52962763 GCAGCTGTGATCCATGGATCAGG - Intergenic
1097263822 12:57734721-57734743 GAAGGCAGGATGCATGGGTCTGG + Intronic
1097805647 12:63961739-63961761 GAATGTAAGCTCCATGAATCAGG - Intronic
1098029724 12:66241303-66241325 GAGGATATGAACCATGGATATGG + Intronic
1103034303 12:117643935-117643957 GAATGAATGATCCTTGGATGGGG + Intronic
1107258386 13:38459360-38459382 AAAGGTGTGCTCAATGGATCTGG + Intergenic
1107382668 13:39874452-39874474 GAAGGTATGATTAATGTAGCTGG + Intergenic
1107885934 13:44874203-44874225 GAAGGTTTGAAGGATGGATCTGG - Intergenic
1108830647 13:54474042-54474064 GGAGGACTGATCCATGGAACTGG - Intergenic
1109117482 13:58406978-58407000 GAAGGTACCATCTATGAATCAGG + Intergenic
1109219837 13:59629838-59629860 GAAGGTGTTGTCCATGGATAGGG + Intergenic
1113166386 13:107448177-107448199 GAAGGTATGAGCCAGTGATGTGG - Intronic
1114673046 14:24423067-24423089 GAAGTTATGAGCCATGGCTGAGG + Intergenic
1115531522 14:34332496-34332518 CAAGGAATGATTCATGAATCGGG - Intronic
1116228444 14:42183498-42183520 GAATGTATGTCCCATGGATGAGG - Intergenic
1117830654 14:59746444-59746466 GAAGGTGTGGTCCATGGCACTGG + Exonic
1118034677 14:61853563-61853585 GAAGGTACCATCTATGAATCAGG + Intergenic
1118337313 14:64864862-64864884 GAAGGTCTGGACCATGGATCAGG + Intronic
1202943179 14_KI270726v1_random:2394-2416 CAATGGATGATTCATGGATCAGG + Intergenic
1125087374 15:35746296-35746318 GAGGGTATGAACCATGGTACTGG - Intergenic
1126156991 15:45574641-45574663 GAAAATACGATCCATGGAGCAGG - Intergenic
1126898575 15:53286762-53286784 CAAGGTGTGATCCATGTACCTGG - Intergenic
1129354723 15:74982280-74982302 AAAGGGATGTTCCAGGGATCAGG + Intronic
1131849579 15:96524535-96524557 GAAGAAATGGTCCATGGATTTGG + Intergenic
1134472262 16:14535887-14535909 GAATGTATCCTCCATGGATAAGG + Intronic
1134889488 16:17826771-17826793 GAAAGGAGGATGCATGGATCTGG - Intergenic
1139870786 16:70107368-70107390 GAAGGTGGGGTCCATGGTTCAGG + Intergenic
1140376091 16:74446509-74446531 GAAGGTGGGGTCCATGGTTCAGG - Intergenic
1141942164 16:87284251-87284273 CAATGTGTGTTCCATGGATCAGG - Intronic
1142223369 16:88865899-88865921 GAAGGTGTGTGCCATGGAGCAGG - Exonic
1146685614 17:34839645-34839667 CAAAGTGTGATCCATGGACCAGG - Intergenic
1150540919 17:66098269-66098291 CAAAGAATGATTCATGGATCAGG - Intronic
1153908981 18:9689853-9689875 CAAAGAATGATTCATGGATCAGG - Intergenic
1156513001 18:37657057-37657079 GAAGGTATGATACAAGAATAGGG - Intergenic
1156579239 18:38356129-38356151 AAAGGTATATTCCATGGGTCTGG + Intergenic
1157865068 18:51175695-51175717 GCTGGTATGATCAGTGGATCAGG - Exonic
1158409533 18:57193208-57193230 AAAGATGTGATCCAAGGATCAGG + Intergenic
1164172197 19:22735021-22735043 GAGGCTATGATGCATAGATCCGG - Intergenic
1166774507 19:45304102-45304124 GTAGGTTTGATCCAGGCATCAGG + Intronic
925099127 2:1230652-1230674 TAAGGTGGGACCCATGGATCTGG - Intronic
926505570 2:13710603-13710625 GAAGGTATCATCTATGAATCAGG - Intergenic
926851808 2:17206328-17206350 GTAGATATGATCCATTCATCTGG + Intergenic
927838509 2:26421435-26421457 GAAGGTAATCTCCATGGGTCCGG + Intronic
928400617 2:30976000-30976022 GCAGGTATGATCCATGGAATTGG - Intronic
929771902 2:44899334-44899356 CAAGGTGTGATCCAGGAATCAGG - Intergenic
933510712 2:83238022-83238044 GAATGTATGACCCTTGGATAAGG - Intergenic
934753852 2:96811474-96811496 GAAGGGATGATCAATGGGCCAGG - Exonic
936787108 2:116106948-116106970 GAAAGTATCCTCCATGGATAAGG - Intergenic
937500796 2:122476332-122476354 AAAGATATGATCCATGTATGTGG - Intergenic
940377722 2:152975225-152975247 TCAGGTATCATCCATGGAGCTGG + Intergenic
941379930 2:164779863-164779885 GCAGGTATGAGACATGGGTCAGG + Intronic
941478313 2:165974443-165974465 GAATGTATAATCCATTGATTTGG - Intergenic
943185358 2:184599236-184599258 GAAGCTGTGATCCATGGCTTTGG + Intronic
943324715 2:186484574-186484596 GAAGTTATGAACCATGAAACTGG + Intergenic
1169541889 20:6608376-6608398 GAAAGTTTGATTCATGCATCAGG - Intergenic
1173092265 20:39984572-39984594 AAAGGTCTGATCCATGGCACAGG - Intergenic
1176937269 21:14881954-14881976 GAAGGTATGATCCATGGATCAGG - Intergenic
1177939774 21:27395064-27395086 GATGGTATGTTTCATGGGTCAGG - Intergenic
1178224729 21:30702062-30702084 GAAGGCATCATCCATGAATGTGG + Intergenic
1180125786 21:45789533-45789555 GAGGGTGTGAGCCATGGATGAGG + Intronic
1182937982 22:34244568-34244590 CAAGGTGTGGTCTATGGATCAGG + Intergenic
1182995585 22:34808956-34808978 GAAGGTCTGACCCATGCCTCAGG - Intergenic
949093835 3:62264-62286 GAAGCTATGATCTCTGGGTCTGG - Intergenic
954530728 3:51317136-51317158 TAAGGTATGAAGGATGGATCAGG + Intronic
954889864 3:53915700-53915722 GAAGGTGTCCTCCATGGATAAGG + Intergenic
955876808 3:63499182-63499204 AAAGGTATAATCCATAGAACTGG + Intronic
956961650 3:74409454-74409476 AAAGAAATGATTCATGGATCAGG - Intronic
957397434 3:79660383-79660405 GAATGTAAGACACATGGATCAGG + Intronic
960957358 3:123042716-123042738 CAAGGGAAGATCCAGGGATCTGG - Intergenic
963928143 3:150973381-150973403 TTAGGTATAAACCATGGATCTGG - Intergenic
965456243 3:168904185-168904207 GAATGTATTCTCCATGGATGGGG + Intergenic
967455018 3:189675102-189675124 GAAGGTATCATCTATGAATAAGG - Intronic
969901134 4:10350533-10350555 TAAGGTATGTTCCATGGCCCTGG - Intergenic
974239238 4:59223903-59223925 GAATGTATGATCCAGGAAACAGG - Intergenic
978452852 4:108854955-108854977 AAAAATATGATTCATGGATCAGG - Intronic
979742001 4:124162508-124162530 GAAGGCATGAGCTCTGGATCAGG - Intergenic
981045836 4:140264230-140264252 GAAGGGATGATCACTGGAGCTGG - Intronic
988313191 5:29588558-29588580 GAAGGTATCTTCCATGGATAAGG - Intergenic
993697390 5:91077913-91077935 TGAGGAATGATTCATGGATCAGG + Intronic
996362428 5:122664739-122664761 GTTGGTTTGATCCATGGATGTGG - Intergenic
996793436 5:127318158-127318180 GAAGGTACCATCTATGAATCAGG + Intronic
998880859 5:146643340-146643362 GAATATAGGCTCCATGGATCAGG - Intronic
999975971 5:156912402-156912424 GATGTTTTGATCTATGGATCAGG + Intergenic
1000456268 5:161453502-161453524 GAAGGTATCATCCATGAATCAGG + Intronic
1002345187 5:178543915-178543937 GAAGGCATCATCCATGAACCAGG - Intronic
1005753939 6:28909047-28909069 GGAGGTGTGATCCAAGGTTCAGG + Exonic
1011153309 6:84299814-84299836 GAAGGAATGATTCATGAATTGGG - Intergenic
1014190614 6:118492349-118492371 GAAAGTAAGATCCATGAATCGGG + Intronic
1016580657 6:145626347-145626369 GAAGCAATTATCCATGGATTTGG + Exonic
1016881911 6:148919964-148919986 CAAAATATGATTCATGGATCAGG + Intronic
1018614016 6:165668951-165668973 GAAAGTTTGATGCAGGGATCAGG + Intronic
1023122206 7:36921076-36921098 GAAGGCATCATCTATGGAGCAGG + Intronic
1023366817 7:39472913-39472935 GGATTTTTGATCCATGGATCTGG + Intronic
1026319774 7:69258419-69258441 GAAGGGCTGGTCCATGGACCTGG + Intergenic
1028369302 7:90072630-90072652 GAATGTATATTCCATGGATTTGG - Intergenic
1028559184 7:92154811-92154833 GAAGGTATCTCCCATGGATAAGG - Intronic
1031500375 7:122507251-122507273 GAAGGAATGAGCCATGCATGGGG + Intronic
1034521654 7:151625266-151625288 GAAGGAATGATTCAAGGAGCAGG + Intronic
1036166370 8:6437843-6437865 GGAGGGATGATCCAGGCATCAGG - Intronic
1037212785 8:16412543-16412565 GAAGGCATGTTACATGGATTAGG - Intronic
1038098078 8:24338351-24338373 GAAGGTATCATTCATATATCTGG - Intronic
1048918743 8:139208651-139208673 TAAAGTATGGTCCACGGATCAGG - Intergenic
1052083408 9:24234745-24234767 GAAGGTGTGATCTATGAATCAGG - Intergenic
1055557207 9:77487170-77487192 GAAGGGATGATTCATGGCCCAGG + Intronic
1055768688 9:79692689-79692711 GAAGGCATCATCTATGAATCAGG - Intronic
1058500958 9:105615688-105615710 GAATGTATTGTCCATGGATAAGG - Intronic
1059541529 9:115135247-115135269 GGAGGAATGATTTATGGATCAGG - Intergenic
1187178181 X:16915812-16915834 GAAGGCATCATCTATGAATCAGG + Intergenic
1187768289 X:22667469-22667491 GAAGGTATGCTCCCAGGAACTGG + Intergenic
1188115385 X:26237217-26237239 GTAATTATGATCCATGGATGAGG - Intergenic
1191143300 X:57137340-57137362 GAGGGTAGGATCCATAGATGAGG + Intronic
1194156778 X:90399864-90399886 GTTGGTATGAGCCATGGGTCAGG + Intergenic
1198850671 X:140962685-140962707 GAAGGTATCACCTATGAATCAGG - Intergenic
1200503125 Y:3976850-3976872 GTTGGTATGAGCCATGGGTCAGG + Intergenic