ID: 1176937270

View in Genome Browser
Species Human (GRCh38)
Location 21:14881960-14881982
Sequence CAGAGAGAAGGTATGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176937270_1176937272 -10 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937272 21:14881973-14881995 CTTCTCTCTGTATACTCACATGG No data
1176937270_1176937278 17 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937278 21:14882000-14882022 AGGGCCAAGGGATCTCTCTCAGG No data
1176937270_1176937275 -2 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937275 21:14881981-14882003 TGTATACTCACATGGTGGAAGGG No data
1176937270_1176937273 -7 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937273 21:14881976-14881998 CTCTCTGTATACTCACATGGTGG No data
1176937270_1176937279 18 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937279 21:14882001-14882023 GGGCCAAGGGATCTCTCTCAGGG No data
1176937270_1176937277 5 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937277 21:14881988-14882010 TCACATGGTGGAAGGGCCAAGGG No data
1176937270_1176937274 -3 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data
1176937270_1176937276 4 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176937270 Original CRISPR CAGAGAGAAGGTATGATCCA TGG (reversed) Intergenic
901474732 1:9481629-9481651 CAGAGAGAAGGAGAGAGCCAGGG + Intergenic
903023579 1:20411402-20411424 CAGAGAGCAGGGATGAGTCAGGG - Intergenic
906285594 1:44585711-44585733 CAGAGCCAAGGTATGAACCTAGG - Intronic
906954306 1:50359479-50359501 CAGTGAGGAGGGATGAGCCAGGG - Intergenic
907371398 1:54005800-54005822 CAGAGAAAAGGGATGATCAAGGG - Intergenic
907564391 1:55421257-55421279 CAGAGAGAAACTCTGATTCAAGG + Intergenic
907999527 1:59666761-59666783 CATAAAGAAGGTGAGATCCAAGG - Intronic
909079139 1:71087903-71087925 CACAGAGAGGGTATAATACAGGG + Intergenic
909927169 1:81451134-81451156 AAGAAAAAAGGTATGATCAATGG - Intronic
913179654 1:116309293-116309315 CAGAGAGAGCGTCTGATCCAAGG + Intergenic
915141371 1:153770637-153770659 CAGGGGGAAGGTATGATTCCAGG - Intronic
915888628 1:159750010-159750032 CAGAGAGATGTTAGGATCAATGG - Intergenic
916000387 1:160609445-160609467 CATAGAGGAGGTAAGATACAAGG + Exonic
917682753 1:177384612-177384634 CAGTGAGAAGGGATGAGTCAGGG + Intergenic
919396301 1:197053191-197053213 CAGTTAGAAGGTAAGCTCCATGG - Intronic
919965269 1:202517040-202517062 CAGAGAGAAAGTCTAATTCAGGG + Intronic
920507997 1:206530675-206530697 CAGGGAGGAGGGATGTTCCAGGG + Intronic
922746703 1:228048263-228048285 GAGAGAGAAGGTCAGAGCCAAGG + Intronic
1064883963 10:20088668-20088690 CAGAGACAAGATGTGAACCAAGG - Intronic
1065679456 10:28213857-28213879 CAGAGGGAATGAAGGATCCAGGG + Intronic
1067432838 10:46255258-46255280 CAGAGAGAATTTATTATTCATGG - Intergenic
1068708699 10:60107417-60107439 TGGAGAGAAGGTATGAACAAGGG + Intronic
1069492717 10:68875131-68875153 CTGAGAGAAGGTCTGACACAGGG - Intronic
1069630012 10:69891929-69891951 CTGAGAGGAGGTGTGATCGAGGG - Intronic
1069985275 10:72278672-72278694 TAGAGAGAGGGCATGACCCAAGG - Intergenic
1070343974 10:75523801-75523823 CAGAGAGAAGAAAGGATGCAGGG - Intronic
1071008645 10:80912329-80912351 CAGAGAGTAGGCATGTTCCATGG + Intergenic
1071672732 10:87624683-87624705 AAGAGAGAACTTATGATCCCCGG - Intergenic
1071887554 10:89967559-89967581 CAGAGAGGAGGAAAAATCCAGGG - Intergenic
1073513181 10:104055343-104055365 CAGAGACAAGGTTCAATCCATGG + Intronic
1075441626 10:122484421-122484443 CACTGCGAAGGTATGATCCAGGG - Intronic
1076245580 10:128945161-128945183 CAGAGAGAAGGTTAGCACCAGGG - Intergenic
1076541326 10:131216955-131216977 CAGCCAGAAGGGATGAGCCATGG - Intronic
1077949952 11:6945868-6945890 CAGAGAAAAAGTCTGATCCAAGG - Intronic
1079331264 11:19534858-19534880 CAGAGTGAAGATTTGAACCAAGG - Intronic
1085207219 11:74742979-74743001 CAGAGAGAAAATAAGAGCCAAGG - Intergenic
1086286820 11:85261104-85261126 AAGAGAGAAAGTATGTTGCAAGG + Intronic
1086287237 11:85263907-85263929 TAGAGAGAAAGTATATTCCAAGG + Intronic
1087209496 11:95432253-95432275 GAGTGAGAAGGTCAGATCCATGG + Intergenic
1087624671 11:100582929-100582951 CAGAGAGAAGGTATCAAGTAAGG - Intergenic
1090311396 11:125744362-125744384 CAGAGATGAGGTATAAGCCAGGG + Intergenic
1090620174 11:128553634-128553656 CAGAGAGAAAGTATGAATGAGGG - Intronic
1093770090 12:23007988-23008010 CATAGAGAACTTGTGATCCAAGG + Intergenic
1094044499 12:26152681-26152703 CACAGATAAGGAATGAACCAGGG - Intronic
1094665188 12:32513139-32513161 CAGAGAGAAGGGAGGACTCATGG + Intronic
1094852543 12:34388737-34388759 CACTCAGAAGGTGTGATCCAGGG + Intergenic
1100041576 12:90325679-90325701 CAGATATAAAGTCTGATCCATGG + Intergenic
1101579105 12:106025909-106025931 CAGAAGGAAGGTAACATCCACGG + Intergenic
1108682598 13:52792379-52792401 GAGAGAGAATATATGAGCCAGGG + Intergenic
1108776242 13:53768612-53768634 CAAAGAGAATGAATGAGCCAAGG + Intergenic
1109515531 13:63439036-63439058 TAGAGAGAAAGTATGCTGCAGGG + Intergenic
1110546207 13:76758418-76758440 CAGACAGAAGGAATGATCAAGGG - Intergenic
1114191872 14:20445638-20445660 CAGAAAGGAAGTATGATCAATGG + Intergenic
1115074176 14:29365607-29365629 CAGAGAGAAGTGAAGATCAATGG + Intergenic
1115845738 14:37531369-37531391 CAGAGAGAAGGAAGGCTTCAAGG - Intronic
1116251491 14:42489134-42489156 CAGAGAGAAAGGCTGCTCCAAGG + Intergenic
1117125565 14:52620120-52620142 CTGAGAGAAGGTCCCATCCATGG + Intronic
1117662496 14:58021885-58021907 CACAGAGAAGGTATCACCCTAGG + Intronic
1118765875 14:68909029-68909051 CAGAGGGATGGAATGATACATGG - Intronic
1119416308 14:74472282-74472304 CAGAAAGAAGGTAAAAGCCAGGG - Intergenic
1121611308 14:95282739-95282761 CAGAGAGAAGGTCAGAATCAGGG + Intronic
1121996131 14:98604812-98604834 CAGAGAGAAGGCATCCTCCAGGG - Intergenic
1122351684 14:101098637-101098659 TAGAGAGAAAGTATGTTTCAAGG + Intergenic
1123048704 14:105530544-105530566 CACAGGGAAGGTAGGTTCCACGG - Intergenic
1123950168 15:25264078-25264100 CATAGAGAAGGGATGATCAGTGG + Intergenic
1124166507 15:27330871-27330893 CAGAGTGAATGTAGGAGCCAGGG + Intronic
1125957511 15:43800510-43800532 CAGAAAGAAGGTGTGGCCCAGGG + Exonic
1126101533 15:45120908-45120930 CTGAGAGAAGGTAGCTTCCAAGG + Intronic
1126361623 15:47852399-47852421 CAGACACAAGGAATGATCCATGG + Intergenic
1127098573 15:55537923-55537945 CAGAAAGAAAGCATGAGCCATGG - Intergenic
1127553711 15:60066427-60066449 CAGAGAGACAGAATGAGCCAGGG - Intergenic
1128399605 15:67264712-67264734 CAAAGAGAAGGGATTATACAAGG + Intronic
1130748993 15:86689371-86689393 CAGCTAGAATGTATAATCCATGG + Intronic
1131681788 15:94731207-94731229 CAGAGAGAAAGGATGATCAATGG - Intergenic
1132031566 15:98442522-98442544 CAGAGGTAAGTTATCATCCAAGG + Intronic
1134776942 16:16861734-16861756 CAGAGGGATGGTACGAACCAGGG - Intergenic
1137801208 16:51263780-51263802 CAGTGTGAAGGGATGAGCCAAGG + Intergenic
1137848761 16:51717138-51717160 CAGAAAGAAGATTTGATCCCAGG + Intergenic
1137968252 16:52958277-52958299 CAGAGAGAAGGAATGAAGGAAGG + Intergenic
1138138368 16:54544422-54544444 CAGAGAGAAGGGAGCATCCGAGG + Intergenic
1138390062 16:56663436-56663458 AAGAGAGAGGGGATGATCCGTGG - Intronic
1138680133 16:58678288-58678310 CAGACAGAAGCTATGATCCTGGG - Intronic
1140236471 16:73163762-73163784 GAGAGAGATGGAATAATCCAAGG + Intergenic
1140683389 16:77408714-77408736 CTGAGAGAAGGTATGAGTGAAGG + Intronic
1140761038 16:78109164-78109186 CTGAGATAATGTATGATCCACGG + Intronic
1140806331 16:78535612-78535634 CAGTCAGAAGGTATCAGCCAAGG - Intronic
1141890357 16:86922411-86922433 GAGAGAGAAGGTCTCAGCCAGGG - Intergenic
1145890592 17:28412464-28412486 CAGAGAGAAGACATGATAAAGGG + Intergenic
1146582452 17:34050990-34051012 GAGAGAGCAGGTTTGATTCATGG - Intronic
1148630805 17:49106860-49106882 CAGAGACAAGGAATGACCCAGGG - Intergenic
1149132981 17:53329741-53329763 CAGTGAAAAGGTATAATCAAAGG - Intergenic
1149720652 17:58840883-58840905 TAGAGAGAAAGTATGTTGCAAGG + Intronic
1152061332 17:78077968-78077990 CAGAGAGAAGGGATGTCCTAGGG - Intronic
1153158171 18:2172644-2172666 CAGAGAGATAGTATGGTCCCTGG - Intergenic
1158334441 18:56400333-56400355 CAGAGAGAAGAAATCATACATGG + Intergenic
1161668899 19:5593580-5593602 CAGAGAACAGCTATGCTCCACGG + Intronic
1164766045 19:30770885-30770907 CAGAGTAAAAGAATGATCCATGG - Intergenic
1166647725 19:44544456-44544478 CAGACAGAAGGGAAGATCAATGG - Intergenic
1166880871 19:45929290-45929312 CAGAGAGAGGGAGGGATCCAGGG + Intergenic
1167633307 19:50639139-50639161 GAGAGAGAATGTCTGATCTAGGG + Intronic
1167791295 19:51684359-51684381 CAAAAAGAAGGTATGGCCCAAGG + Intergenic
925304187 2:2837298-2837320 CGGAGGGAGGGTATGATCCTGGG - Intergenic
926550175 2:14291867-14291889 TAGAGAAAAGGAATGACCCAGGG + Intergenic
926805959 2:16711242-16711264 CAGAGAGAAGGTAGGAGACCAGG + Intergenic
927107757 2:19842444-19842466 CAGAGTGAACGTGTGACCCAGGG - Intergenic
927682227 2:25147174-25147196 AAGAGAGAAGGGATGCTCCCTGG - Intronic
931088907 2:58864886-58864908 AAGAGATAAGGTATGGTGCAGGG + Intergenic
932359295 2:71091344-71091366 CAGGGAGAAGCTACTATCCAAGG + Intergenic
933646219 2:84814733-84814755 CAGAGACATGGTATGAACTAGGG - Intronic
934512829 2:94960972-94960994 CAGAGAGAAGGAAGGAGCCTGGG - Intergenic
934753854 2:96811480-96811502 CTGTGAGAAGGGATGATCAATGG - Exonic
934964554 2:98709036-98709058 CAGAAAGAAGGTCTGAACCTAGG - Intronic
935258916 2:101337809-101337831 ATGAAAGAAAGTATGATCCAAGG - Intergenic
935445871 2:103155929-103155951 CAGAGAGAAGGGCTCAGCCATGG - Intergenic
935833580 2:107025537-107025559 GAGAGAGATGGGATGGTCCAGGG + Intergenic
936103844 2:109607401-109607423 CATTGAGAATGCATGATCCATGG - Intronic
936522364 2:113219321-113219343 CAGACAGAAGCAGTGATCCAAGG - Intronic
936618054 2:114068458-114068480 GAGAGAGAAGACATGATACAGGG - Intergenic
941885366 2:170522142-170522164 GTGAGAGATGGTATCATCCAGGG - Intronic
942473026 2:176282466-176282488 CAGATAGAAGGTAGGAGGCATGG - Intronic
942586029 2:177479052-177479074 CAGAGAGAATCTCTGAACCACGG + Intronic
943582665 2:189702904-189702926 CAGAGAGCAGGAATAGTCCAGGG + Intronic
944283132 2:197921685-197921707 GAGAGAGACGGTGTGATCAAAGG - Intronic
945851051 2:215007580-215007602 CAGAGAGAAGGTCTGAGACAGGG - Intronic
947822486 2:233081788-233081810 CACAGAGAAGAGCTGATCCATGG - Intronic
948306980 2:236955616-236955638 CAGTGAGAAAGGATGACCCAGGG - Intergenic
948593623 2:239066144-239066166 CAGAGAAAAAGAATGTTCCACGG - Intronic
948720159 2:239894303-239894325 CAGAGAGAAGGAATGAGGCTGGG - Intronic
1169315853 20:4590555-4590577 CAGCAAGAAGGTACCATCCATGG + Intergenic
1169639070 20:7728261-7728283 CAGTGAGAATGTATGAACCCAGG - Intergenic
1170038748 20:12018192-12018214 CTGAGAGAATGGATCATCCATGG + Intergenic
1176363213 21:6016089-6016111 AAGAGAGTAGGTATGAGCCATGG - Intergenic
1176937270 21:14881960-14881982 CAGAGAGAAGGTATGATCCATGG - Intergenic
1178053402 21:28771932-28771954 CATAGAAATGGTATGTTCCAGGG - Intergenic
1179268009 21:39822435-39822457 AAGAGAAAAGGGATGATCCAAGG - Intergenic
1179760305 21:43522456-43522478 AAGAGAGTAGGTATGAGCCATGG + Intergenic
1184170824 22:42758796-42758818 CCTAGAAAAGGTAGGATCCAAGG + Intergenic
1185379097 22:50498819-50498841 GAGAGAGAAGGCAGGAGCCAGGG - Intergenic
949756409 3:7416147-7416169 CAGAGAGAATGTGTGAGCCAAGG + Intronic
950756288 3:15175548-15175570 CAGAGAGAAGGAAAGGTACAGGG - Intergenic
950979790 3:17289785-17289807 CAGAGCCAAGGTTTGACCCAAGG + Intronic
951018044 3:17751334-17751356 CACAGAGAACATATGATTCAAGG - Intronic
951691940 3:25405921-25405943 CAGAGGGACGGCATGAGCCAAGG + Intronic
954554609 3:51508051-51508073 TAGAGAAAAGGAATGATGCAAGG + Intergenic
956790840 3:72678866-72678888 TAGACAGAAAATATGATCCATGG + Intergenic
957388282 3:79526520-79526542 CACAGAAAATGTATGATGCATGG - Intronic
960167194 3:114416406-114416428 CAGAGAATATTTATGATCCAAGG - Intronic
960865203 3:122192833-122192855 CAGAGAAAAGAGGTGATCCATGG - Intronic
962110272 3:132438231-132438253 CAGGGAGAAGTTAAGATTCAAGG - Intronic
962622790 3:137196442-137196464 TAGAGAGAAATTTTGATCCAGGG - Intergenic
964069485 3:152614364-152614386 AAGACAGAAGTTATGATTCAAGG - Intergenic
964203346 3:154142759-154142781 CATAGTGAAGGTATGAGTCAAGG - Intronic
965267730 3:166567760-166567782 AAGAGACAAGATATGATACATGG - Intergenic
966442103 3:179957223-179957245 AAGAGAGAAAGTATCACCCATGG - Intronic
967055790 3:185826854-185826876 CAGAGAGAAGGTCTGAGTCCGGG - Intergenic
969252525 4:5977768-5977790 CAGACAGAAGGTTTAATCCAAGG - Intronic
970299924 4:14670386-14670408 CAGAAAGAAGCTCTGATCAAGGG - Intergenic
971120473 4:23698838-23698860 CAGAGAGAAGTAATGATATAAGG + Intergenic
979431623 4:120639488-120639510 CAGTGAGAAGTTATGGTCTAGGG - Intergenic
980364602 4:131784824-131784846 CAGAGAGAAGGAAACATCTATGG + Intergenic
982248297 4:153378184-153378206 CAAAGAAAAGGTATGGGCCAGGG - Intronic
983199605 4:164846660-164846682 GAGAGAGACGGGATGATCAAGGG - Intergenic
984413423 4:179426366-179426388 CAGTGAGAAGGTTTGATCAAGGG + Intergenic
984655798 4:182316919-182316941 CAGTAAGCAGGTGTGATCCATGG + Intronic
985322800 4:188733691-188733713 GAGATAGAAGGTATTATCCCAGG - Intergenic
987662618 5:20896241-20896263 CAGAGAGAAATAATGAGCCATGG - Intergenic
988760964 5:34309077-34309099 CAGAGAGAAATAATGAGCCATGG + Intergenic
988872562 5:35406827-35406849 CAGTCAGTAGGTATCATCCAGGG - Intergenic
988956534 5:36325297-36325319 CAGAGAGAAGGCAAGGTCAAAGG - Intergenic
992530872 5:77650709-77650731 CAGAGACAAGCTAAGACCCAGGG - Intergenic
992847047 5:80760992-80761014 CAAAGAGCAGGTATCATACAAGG - Intronic
993584131 5:89702052-89702074 CAAAGAGAAGGAAACATCCATGG - Intergenic
993760784 5:91794319-91794341 GAAAGAAAAGGTATTATCCAAGG + Intergenic
995328481 5:110919364-110919386 CAGAGTGAAGGTGTGGTGCAAGG - Intergenic
996035050 5:118749616-118749638 CTGAGAGAACCTAAGATCCAGGG - Intergenic
996629208 5:125607356-125607378 CAGAGAAAAAGTGTGCTCCATGG - Intergenic
997015584 5:129930561-129930583 CATAGAGAAGGAATGAAACAAGG + Intronic
997228995 5:132229091-132229113 GAGAGAAAAGGGATGTTCCATGG - Intronic
998399582 5:141841631-141841653 CAGAGAGCAGGTACGGGCCAGGG - Intergenic
998703594 5:144732774-144732796 CAGTGAGGATGTATGATCAAAGG + Intergenic
998761538 5:145437728-145437750 GAGAGGGAAGGAATGAACCAAGG - Intergenic
1000043684 5:157504027-157504049 CAGTGGGAAGGTATGCTCCAAGG + Intronic
1000348132 5:160331529-160331551 CAGAGAGGAGATAAGATCCAGGG - Intronic
1001101402 5:168817480-168817502 CAGAGAGAAGGCATGGTCACAGG + Intronic
1002864712 6:1110772-1110794 CAGAGAGCAGGTGTGATGGAGGG - Intergenic
1003110835 6:3250946-3250968 CAGAGTGAATGTATGATCAAAGG + Intronic
1003483506 6:6554701-6554723 CAGAGAGAAATTGTGATTCATGG + Intergenic
1003635782 6:7830302-7830324 CAGAAACAAGGTTTAATCCAGGG - Intronic
1004459281 6:15820629-15820651 CAGAGAGAAGAAATGAAACAGGG + Intergenic
1005570245 6:27138453-27138475 TAGAGAGAAGGAATGGACCAAGG + Intergenic
1006732708 6:36248057-36248079 CAGAGAGAGGGCATGGTACACGG - Intronic
1010359617 6:74977768-74977790 CAGGGAGAATGGGTGATCCAGGG - Intergenic
1010568022 6:77441412-77441434 CAAAGAGAAGCTATGACACAGGG + Intergenic
1012355577 6:98310010-98310032 CAGAGAGAAGGTCTGAGATAAGG - Intergenic
1013839450 6:114372941-114372963 CAGAGAGAAGGAAAGAGCTAAGG + Intergenic
1015286144 6:131488636-131488658 TAGAGAGAATATCTGATCCAGGG + Intergenic
1017225322 6:152014595-152014617 GAGGGAGAAGGTAGAATCCATGG - Intronic
1017295852 6:152793042-152793064 GAGAAAGAAGGTATGAACCTGGG + Intergenic
1018488697 6:164270002-164270024 CAGAGAGAAAGAAAGATCAAGGG - Intergenic
1018614015 6:165668945-165668967 GAGAGAGAAAGTTTGATGCAGGG + Intronic
1019108307 6:169688384-169688406 CGGAGAAAAGGCATGATCTAGGG + Intronic
1022554366 7:31277357-31277379 GAGAGAGAAGATAAGAGCCATGG + Intergenic
1024846033 7:53643367-53643389 CAGAGAGAAGAAATGGACCAGGG + Intergenic
1026433281 7:70369517-70369539 CAGAGTGATGGTATCATTCAAGG + Intronic
1031411061 7:121440811-121440833 AAAAAAGAAGGTAGGATCCAGGG + Intergenic
1032408271 7:131673587-131673609 CAGAGAAAAGTTATGTACCAAGG - Intergenic
1032533603 7:132642485-132642507 CAGGGAGAAGGGATATTCCAAGG + Intronic
1033366796 7:140678241-140678263 AAGAGAGAAGGCATGATCTGGGG + Intronic
1036584052 8:10106786-10106808 CAGACAGAAGGAATGACCTAAGG - Intronic
1037886985 8:22600442-22600464 CAGAGAGCAGGTTGGATCCCAGG + Intronic
1039766447 8:40633401-40633423 CAGAGAGAGGATATGATGTAGGG + Intronic
1040461409 8:47652488-47652510 CAGAGAGAAGGAAGGTTCCCAGG - Intronic
1041957666 8:63574140-63574162 CAGAGTGAAGGTTTGGACCAAGG + Intergenic
1044330268 8:90911559-90911581 CAGATTGAAGCTGTGATCCATGG - Intronic
1044549094 8:93492539-93492561 CAGAGGGAAGGCATGATCAGAGG - Intergenic
1044808308 8:96031301-96031323 CAGATGGAAGGTAAGAGCCAAGG - Intergenic
1044995200 8:97831624-97831646 CAGGGAGAAGGAATTTTCCATGG + Intronic
1045353561 8:101364343-101364365 GAGAGAGAAGGTGTGGCCCAGGG - Intergenic
1046560836 8:115835379-115835401 CAGTGAGAAAGTAAGAGCCAAGG - Intergenic
1047184087 8:122616392-122616414 CAGGGAGAGGGTAGGATCCAAGG + Intergenic
1047512143 8:125523555-125523577 CAGAAAGATAGAATGATCCAGGG + Intergenic
1047664829 8:127080095-127080117 CAGAGGGAAGGTATTTGCCAAGG + Intergenic
1048629559 8:136227221-136227243 CAGAGGCAAGGTATGATAGATGG - Intergenic
1048884293 8:138897161-138897183 CAGAGAGAAGATATGAATCCAGG + Intronic
1050672523 9:8013630-8013652 CAGACCTAAGGTAAGATCCAAGG - Intergenic
1053209463 9:36215547-36215569 TAGAGAGAGGGTTTGATCCCAGG - Exonic
1054815073 9:69466817-69466839 GAGAGAGAAGGTATGAAATATGG + Intronic
1055861727 9:80758551-80758573 CAGAGAGAATGAATGAGGCAGGG + Intergenic
1057209529 9:93192331-93192353 GAGAGAGAAGGTAGGAATCATGG + Intronic
1058740051 9:107933918-107933940 CAGAAAGAGGGTATGATTCTAGG + Intergenic
1058793648 9:108475750-108475772 CAGACAACAGGTATTATCCATGG + Intergenic
1059405423 9:114096111-114096133 CAGTGAGAAGGTAGCAGCCACGG - Exonic
1060702627 9:125771568-125771590 GAGAGGGAAGGTATCATGCAAGG - Intronic
1186033382 X:5393754-5393776 CAGAGAGAGAGTGTGCTCCATGG - Intergenic
1186311041 X:8319533-8319555 CACAGAGCAGGTAGGTTCCACGG - Intergenic
1186395612 X:9205893-9205915 TACAGAGAAAGGATGATCCATGG + Intergenic
1186403396 X:9280265-9280287 CAGAGAGAAGGTACCACCCTGGG - Intergenic
1186930667 X:14385782-14385804 CAGAGATGAGGTATGAGACAGGG + Intergenic
1189899934 X:45696086-45696108 CAGAAAGAAGGTCTGAACCAGGG + Intergenic
1190471632 X:50786386-50786408 CAGAGAGAAGATAGGAGCTAGGG - Intronic
1193533635 X:82686554-82686576 CAGTGAGGAGGGATGAGCCAGGG + Intergenic
1196838911 X:119839576-119839598 CAGAGTGAAGGTATCACACAAGG + Intronic
1197168968 X:123410186-123410208 TAGAGAGGAGATATGATCTAAGG + Intronic
1201354478 Y:13082810-13082832 CAGACAGAAGGCATTGTCCAGGG + Intergenic
1202300893 Y:23412855-23412877 CAGAGAGAAAGTCTAATTCAGGG + Intergenic
1202569918 Y:26257743-26257765 CAGAGAGAAAGTCTAATTCAGGG - Intergenic