ID: 1176937274

View in Genome Browser
Species Human (GRCh38)
Location 21:14881980-14882002
Sequence CTGTATACTCACATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176937269_1176937274 3 Left 1176937269 21:14881954-14881976 CCTGATCCATGGATCATACCTTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data
1176937270_1176937274 -3 Left 1176937270 21:14881960-14881982 CCATGGATCATACCTTCTCTCTG 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data
1176937267_1176937274 26 Left 1176937267 21:14881931-14881953 CCATGTCTAGGGAAGGCTGGTTT 0: 1
1: 0
2: 3
3: 12
4: 150
Right 1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176937274 Original CRISPR CTGTATACTCACATGGTGGA AGG Intergenic
No off target data available for this crispr