ID: 1176938354

View in Genome Browser
Species Human (GRCh38)
Location 21:14893585-14893607
Sequence CTGGGGAAGGGACTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176938354_1176938363 16 Left 1176938354 21:14893585-14893607 CCTCATCACAGTCCCTTCCCCAG No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938354_1176938362 15 Left 1176938354 21:14893585-14893607 CCTCATCACAGTCCCTTCCCCAG No data
Right 1176938362 21:14893623-14893645 TAAAGCATATAAGTCCAGGCTGG No data
1176938354_1176938361 11 Left 1176938354 21:14893585-14893607 CCTCATCACAGTCCCTTCCCCAG No data
Right 1176938361 21:14893619-14893641 TAGCTAAAGCATATAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176938354 Original CRISPR CTGGGGAAGGGACTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr