ID: 1176938363

View in Genome Browser
Species Human (GRCh38)
Location 21:14893624-14893646
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176938355_1176938363 4 Left 1176938355 21:14893597-14893619 CCCTTCCCCAGACTTCATTTCCT No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938358_1176938363 -2 Left 1176938358 21:14893603-14893625 CCCAGACTTCATTTCCTAGCTAA No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938359_1176938363 -3 Left 1176938359 21:14893604-14893626 CCAGACTTCATTTCCTAGCTAAA No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938354_1176938363 16 Left 1176938354 21:14893585-14893607 CCTCATCACAGTCCCTTCCCCAG No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938353_1176938363 26 Left 1176938353 21:14893575-14893597 CCTAAGATGACCTCATCACAGTC No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938357_1176938363 -1 Left 1176938357 21:14893602-14893624 CCCCAGACTTCATTTCCTAGCTA No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data
1176938356_1176938363 3 Left 1176938356 21:14893598-14893620 CCTTCCCCAGACTTCATTTCCTA No data
Right 1176938363 21:14893624-14893646 AAAGCATATAAGTCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176938363 Original CRISPR AAAGCATATAAGTCCAGGCT GGG Intergenic
No off target data available for this crispr