ID: 1176942467

View in Genome Browser
Species Human (GRCh38)
Location 21:14940534-14940556
Sequence TCAGTGCCACAGTAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176942465_1176942467 -5 Left 1176942465 21:14940516-14940538 CCTGTAATGGGCACCATTTCAGT No data
Right 1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG No data
1176942462_1176942467 17 Left 1176942462 21:14940494-14940516 CCAGAATTAAGACTGGGCTTTTC No data
Right 1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176942467 Original CRISPR TCAGTGCCACAGTAACAGCC AGG Intergenic
No off target data available for this crispr