ID: 1176942625

View in Genome Browser
Species Human (GRCh38)
Location 21:14942204-14942226
Sequence TCCCCTTAGGTACAACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176942625_1176942628 6 Left 1176942625 21:14942204-14942226 CCATTAAGTTGTACCTAAGGGGA No data
Right 1176942628 21:14942233-14942255 AGTGAAGAGGCAAAATTAAGAGG No data
1176942625_1176942627 -7 Left 1176942625 21:14942204-14942226 CCATTAAGTTGTACCTAAGGGGA No data
Right 1176942627 21:14942220-14942242 AAGGGGAAAAGATAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176942625 Original CRISPR TCCCCTTAGGTACAACTTAA TGG (reversed) Intergenic
No off target data available for this crispr