ID: 1176942627

View in Genome Browser
Species Human (GRCh38)
Location 21:14942220-14942242
Sequence AAGGGGAAAAGATAGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176942621_1176942627 2 Left 1176942621 21:14942195-14942217 CCAGGGGCTCCATTAAGTTGTAC No data
Right 1176942627 21:14942220-14942242 AAGGGGAAAAGATAGTGAAGAGG No data
1176942625_1176942627 -7 Left 1176942625 21:14942204-14942226 CCATTAAGTTGTACCTAAGGGGA No data
Right 1176942627 21:14942220-14942242 AAGGGGAAAAGATAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176942627 Original CRISPR AAGGGGAAAAGATAGTGAAG AGG Intergenic
No off target data available for this crispr