ID: 1176942628

View in Genome Browser
Species Human (GRCh38)
Location 21:14942233-14942255
Sequence AGTGAAGAGGCAAAATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176942626_1176942628 -7 Left 1176942626 21:14942217-14942239 CCTAAGGGGAAAAGATAGTGAAG No data
Right 1176942628 21:14942233-14942255 AGTGAAGAGGCAAAATTAAGAGG No data
1176942625_1176942628 6 Left 1176942625 21:14942204-14942226 CCATTAAGTTGTACCTAAGGGGA No data
Right 1176942628 21:14942233-14942255 AGTGAAGAGGCAAAATTAAGAGG No data
1176942621_1176942628 15 Left 1176942621 21:14942195-14942217 CCAGGGGCTCCATTAAGTTGTAC No data
Right 1176942628 21:14942233-14942255 AGTGAAGAGGCAAAATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176942628 Original CRISPR AGTGAAGAGGCAAAATTAAG AGG Intergenic
No off target data available for this crispr