ID: 1176946523

View in Genome Browser
Species Human (GRCh38)
Location 21:14989067-14989089
Sequence CCTGTACCTGAGCTTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176946520_1176946523 -8 Left 1176946520 21:14989052-14989074 CCTCTAACAAGTCCTCCTGTACC 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG 0: 1
1: 0
2: 1
3: 8
4: 167
1176946518_1176946523 19 Left 1176946518 21:14989025-14989047 CCAGGTTCCTGAAGAGTTCGCTG 0: 1
1: 0
2: 1
3: 13
4: 90
Right 1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG 0: 1
1: 0
2: 1
3: 8
4: 167
1176946517_1176946523 26 Left 1176946517 21:14989018-14989040 CCGATCACCAGGTTCCTGAAGAG 0: 1
1: 0
2: 0
3: 21
4: 140
Right 1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG 0: 1
1: 0
2: 1
3: 8
4: 167
1176946519_1176946523 12 Left 1176946519 21:14989032-14989054 CCTGAAGAGTTCGCTGCATGCCT 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG 0: 1
1: 0
2: 1
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176946523 Original CRISPR CCTGTACCTGAGCTTTGTTG AGG Intronic
904872664 1:33629621-33629643 CCTGTCCCTGAGTTGCGTTGGGG - Intronic
905132359 1:35770305-35770327 CCTGTACCTGAACTTTTTAGAGG + Intergenic
907971090 1:59382436-59382458 CATGTACCTGAGGTTTGCAGAGG - Intronic
909089327 1:71206269-71206291 CCTGTCTCTGAGAGTTGTTGTGG - Intergenic
909767467 1:79374544-79374566 CCTGTTACAGGGCTTTGTTGTGG - Intergenic
913017175 1:114750450-114750472 CATGTAACTGAGCTTATTTGGGG - Intronic
913554187 1:119948628-119948650 GCAGGACCTGAGCTTAGTTGGGG + Intronic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
915243022 1:154537306-154537328 CCAGAACGTGAGCTTTGTGGTGG + Intronic
918729999 1:187981288-187981310 CCTCAACATGAGTTTTGTTGTGG + Intergenic
918983534 1:191595205-191595227 CCTTTGCCTGAGTTTTGCTGGGG + Intergenic
920601173 1:207325424-207325446 TTTTTACCTGAGCTTTATTGAGG + Intronic
921039584 1:211416817-211416839 CCTGTACCTGAGCTGCGCTGCGG + Intergenic
921258613 1:213365327-213365349 CTTCTACCTGAGCTTTCTTTGGG + Intergenic
922807361 1:228397315-228397337 CCTGTGTCTGAGCCTTGCTGCGG - Intronic
923030918 1:230248512-230248534 CCTGTACCCGGACTTGGTTGTGG - Intronic
924854092 1:247858172-247858194 CGTGCACCTGAGCTTTGGAGGGG - Intronic
1066336334 10:34481979-34482001 CCTGTAGCTGAGCATGGTGGGGG - Intronic
1067279934 10:44863535-44863557 CCTGCACCTGAGCGTAGCTGGGG + Intergenic
1067851258 10:49756100-49756122 CCTGTACCCTAGCCTTGCTGTGG + Intronic
1070410380 10:76134021-76134043 TCTGTTCCTGGACTTTGTTGGGG - Intronic
1070839775 10:79476158-79476180 CCTGTTCCCGAGCTTTTTGGAGG - Intergenic
1071924422 10:90389474-90389496 CCAGTACCTAAGCTTGGTTTTGG + Intergenic
1072735141 10:97874093-97874115 CCTGGAGCTGAGCTCTTTTGAGG + Intronic
1073068437 10:100778378-100778400 CGGGTAACTGAGCTTTTTTGGGG + Intronic
1073834023 10:107419907-107419929 CCTTTACCTCAGCTTTGCTAAGG + Intergenic
1074247797 10:111712795-111712817 CCTTTGCCTGAGTTTTGTTTGGG + Intergenic
1074464102 10:113666752-113666774 CCTGGACCTGGGCTTGGTGGTGG + Intergenic
1074757897 10:116640076-116640098 CCTGTACATTAGCTTAGGTGAGG - Intronic
1074991426 10:118712179-118712201 CCTTTACCTGAGTTTTGCTCAGG + Intronic
1084024104 11:66437192-66437214 CCTCATCCTGAGCTTTGATGCGG + Exonic
1084663858 11:70565165-70565187 CCTGGTCTTGAGCTTTGTTCTGG + Intronic
1085710299 11:78823350-78823372 CCTGTGCCTGAGCTTGGCTTGGG - Intronic
1087037768 11:93772177-93772199 CCTTTGCTTGAGCTTTGTTCAGG + Intronic
1088585850 11:111359647-111359669 CCTGTACCTGAATTTATTTGAGG - Intronic
1089453815 11:118614161-118614183 CCTGTACTTGAGCTTAGCAGGGG + Intronic
1089592172 11:119549419-119549441 CCTCTACCTCAGCTTTATTGAGG - Intergenic
1091302126 11:134514543-134514565 CCAGCACCTGAGCTCTGGTGTGG - Intergenic
1096386172 12:51196798-51196820 CCTGTCCCTGAGCATTGGTGAGG + Exonic
1102045654 12:109828561-109828583 TCTGTTCCTGGGCTTTGCTGAGG - Intronic
1103542072 12:121673066-121673088 ACTGGACCTTAGCCTTGTTGGGG + Intergenic
1104269806 12:127273008-127273030 CCTGGACTTCAGCTTGGTTGTGG - Intergenic
1106379698 13:29224147-29224169 CCTTTACCTGAGTTTTGCTTGGG - Intronic
1114902740 14:27085139-27085161 CCTGTGCCTGTGGTTAGTTGGGG + Intergenic
1116149948 14:41128368-41128390 CATGTAGTTGAGCATTGTTGTGG + Intergenic
1117108232 14:52420809-52420831 CCTGCCCCTGAGCATTGTTCAGG - Intergenic
1119583794 14:75812697-75812719 CCTGCCCGTGAGCTTTGTGGAGG + Intronic
1119704945 14:76777660-76777682 CGTTTACCTGGCCTTTGTTGGGG + Intronic
1120009222 14:79394216-79394238 CATGTCACTGAGCTTTGTTCTGG + Intronic
1202842116 14_GL000009v2_random:131513-131535 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1202911505 14_GL000194v1_random:121746-121768 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1124260074 15:28181386-28181408 AGTGTACCTGAGCTTGGTTTGGG - Intronic
1125113919 15:36066871-36066893 CCTTTGCCTGAGTTTTGTTTGGG + Intergenic
1125390062 15:39182689-39182711 CTTTTACCTGAGATTTTTTGGGG - Intergenic
1128072987 15:64808806-64808828 CCTGTACCTCACGTGTGTTGCGG + Intergenic
1130292481 15:82615155-82615177 CCTGTACCCTATCTTTGTTTGGG + Intronic
1131018437 15:89077093-89077115 CCTGTTCCTGAGCTGGGTGGTGG - Intergenic
1131047274 15:89324072-89324094 TCTGAACCTGAGCTTTGGGGAGG - Intronic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1135743343 16:24995505-24995527 CGTGTACCTGAGCTTAAATGGGG - Intronic
1135752872 16:25070846-25070868 CGTGTACCTGAGCTTCAATGGGG + Intergenic
1135986944 16:27190723-27190745 CCTTTGCCTGAGCTTTGCTCGGG - Intergenic
1138594231 16:58021174-58021196 CCTGTACCTTGGCTTTGAAGTGG - Exonic
1139123525 16:64049312-64049334 CATGTACCTGAGCTCCGATGAGG - Intergenic
1143542966 17:7580489-7580511 CCTGGACCTTGGTTTTGTTGGGG - Exonic
1150269621 17:63855238-63855260 TCTGTACCTGAGCTATGTATGGG - Intergenic
1150273659 17:63882453-63882475 CCTTTACCTGAGCCTTGGGGCGG + Intergenic
1150279268 17:63919426-63919448 CCTTTCCCTGAGCATTGCTGGGG + Intergenic
1153322305 18:3785315-3785337 CCTGTTCCTTTGCTTTGTAGGGG + Intronic
1153724126 18:7937578-7937600 CCTTTACCTGAGTTTTGCTCGGG - Intronic
1155276829 18:24196613-24196635 CCTGTATCTAAGCTTTGTGATGG - Intronic
1161533717 19:4805749-4805771 CCTGTCCGTGGGCTTTATTGTGG - Intergenic
1163448723 19:17362951-17362973 CCTGTATTTGAGTTGTGTTGAGG - Intronic
1164984577 19:32638948-32638970 CCTTTGCCTGAGTTTTGTTCGGG - Intronic
1165509298 19:36256957-36256979 GCTTTTCCTCAGCTTTGTTGCGG + Intergenic
1166270486 19:41710443-41710465 CCTGTGCCAGGGCTGTGTTGTGG + Intronic
1167439386 19:49499713-49499735 CCTTTACCAGAGCATTGGTGGGG + Intergenic
925195137 2:1916971-1916993 CCTGTGCAGGAGCTTTGTTAGGG + Intronic
925767358 2:7249359-7249381 CGTGTACCTCTGCTTTCTTGAGG - Intergenic
927051958 2:19338726-19338748 CCTGTAACTGAGATTCATTGAGG - Intergenic
932779625 2:74552018-74552040 CCTGTATCTGGGCTGTTTTGTGG + Intronic
933042733 2:77488494-77488516 CCTTTGCCTAAGCTTTGCTGGGG - Intronic
933701515 2:85258434-85258456 CCTGGGGCTGAGCTTTGATGGGG + Intronic
933945176 2:87279836-87279858 TCTGCACCTCAGCTTTCTTGTGG + Intergenic
934696376 2:96403604-96403626 CCTGTGCCTGAGTTTTGCTCAGG + Intergenic
934700054 2:96431626-96431648 CCTTTGCCTGAGTTTTGTTTGGG - Intergenic
934956067 2:98620969-98620991 CATGTACCTGGACCTTGTTGGGG - Exonic
936335031 2:111581755-111581777 TCTGCACCTCAGCTTTCTTGTGG - Intergenic
937163887 2:119794287-119794309 CCTTTGCCTGAGTTTTGTTCTGG + Intronic
943959252 2:194240471-194240493 CATGTTCTTGAGCTTTGTTCTGG + Intergenic
944276335 2:197842623-197842645 CCTGTACTTAACCTTTTTTGTGG + Intronic
945196058 2:207238581-207238603 GCTGAACCTGATCTCTGTTGTGG - Intergenic
945725613 2:213469748-213469770 ACTGTTCCTTACCTTTGTTGTGG + Intronic
947026000 2:225738547-225738569 ACTGGACCAGAGCTTTGTTAGGG - Intergenic
947673377 2:231956516-231956538 CTTGTACCTTTGTTTTGTTGGGG - Intergenic
948526112 2:238571788-238571810 CCTGCTCCTGGGCTGTGTTGCGG + Intergenic
949051999 2:241902490-241902512 CCTGTACCTGGGCTCTGTGACGG + Intronic
1172166390 20:32902301-32902323 CCTGGAGCTGGGCTGTGTTGTGG + Intronic
1176630864 21:9136415-9136437 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG + Intronic
1178937576 21:36876238-36876260 CCTTTGCCTGAGTTTTGTTCGGG - Intronic
1180219266 21:46347780-46347802 CCTGCCCCTGAGCTGTGTTCTGG + Intronic
1180375723 22:12091191-12091213 CCTTTACCTGAGTTTTGCTTGGG - Intergenic
1180982328 22:19884715-19884737 CCAGGACTTGAGCATTGTTGGGG - Intronic
1182856296 22:33520395-33520417 CCTGTACCTGAGATTCATGGGGG + Intronic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
949618477 3:5783333-5783355 CCTGCAACTGATCTGTGTTGTGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951725544 3:25754274-25754296 CTTGAACCTGAACTTTTTTGTGG + Intronic
953380061 3:42463268-42463290 CCTGGACCTGAACTTTGTACTGG - Intergenic
955808474 3:62761430-62761452 CCTATAATTGAGCTTTGTTTGGG - Intronic
964254903 3:154765648-154765670 CCTTTGCCTGAGTTTTGCTGAGG + Intergenic
965115170 3:164478638-164478660 CCTTTACCTGAGTTTTGCTCAGG - Intergenic
965694853 3:171397336-171397358 CCTTTACATTAGCTATGTTGGGG + Intronic
969298140 4:6281497-6281519 CCTGTCCCTCAGCCTTCTTGTGG - Intronic
969886298 4:10218472-10218494 CCTGAAGCTGAGCTGTGCTGTGG - Intergenic
973032879 4:45365811-45365833 CCAGTACCTGAATTTTGGTGGGG + Intergenic
973865640 4:55110184-55110206 CGTGTAAATGAGCTTTGTGGTGG - Intronic
973934709 4:55832017-55832039 CCAGTACTTGAGCATTGTGGAGG - Intergenic
974310320 4:60199353-60199375 CCTGTTGCTGAGCTTTCATGAGG - Intergenic
975909213 4:79248183-79248205 CCTGTGCATGAGCTATGATGTGG - Intronic
977412780 4:96689478-96689500 CCTGTATTTGAGTTTTGTTTTGG - Intergenic
978394261 4:108261684-108261706 CCGGTACAAGAGCTTTATTGTGG - Intergenic
981748216 4:148070825-148070847 CCTGCACCTGACCATGGTTGGGG + Intronic
981889062 4:149715139-149715161 CCTTTGCCTGAGTTTTGCTGGGG + Intergenic
983893333 4:173054702-173054724 CCTCTGCCTTAGCTTTATTGAGG - Intergenic
984832262 4:183986781-183986803 CCAGAGCCTGAGCTCTGTTGGGG + Intronic
984973484 4:185210111-185210133 CCTGTACCTGAGCTGCGCGGCGG + Intronic
1202757321 4_GL000008v2_random:76632-76654 CCTTTACCTGAGTTTTGCTTGGG - Intergenic
986006323 5:3672017-3672039 CCTGGACCTTAACTGTGTTGGGG + Intergenic
987473636 5:18363425-18363447 TCTGTAACTGAGCTTTGTCAAGG - Intergenic
987502137 5:18726349-18726371 CCTGTAGATAAGATTTGTTGAGG - Intergenic
992468256 5:77028836-77028858 CCTGGGCCTGAGATTTGTGGAGG - Intergenic
992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG + Intergenic
994689025 5:102993400-102993422 CATGTACCTGAGCTATGGTTGGG + Intronic
997430439 5:133835454-133835476 CCTGTTCCTGAAATTTGTTCAGG + Intergenic
997443053 5:133922098-133922120 CCTGCACCTGAGCTTTTCAGAGG - Intergenic
997516741 5:134495400-134495422 CTTATTCCTGAGCTTTGGTGAGG - Intergenic
999505593 5:152192555-152192577 CTTATTCCTGAGCTTTGTGGGGG + Intergenic
1004304659 6:14488702-14488724 CCTGTGCCTGAGTTTTGCTCAGG - Intergenic
1009241576 6:61192579-61192601 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1011672342 6:89695264-89695286 TCTCTACCTGAGCTTAGTTTTGG - Intronic
1012402544 6:98854852-98854874 CATGTACCTGAGCTCACTTGGGG - Intergenic
1014200134 6:118600278-118600300 CCTGTCCCTGAGCCTTCCTGGGG + Intronic
1015073880 6:129131438-129131460 GCTGTATCTGAGCTTCTTTGAGG + Intronic
1015096065 6:129416678-129416700 CCTTTGCCTGAGTTTTGCTGAGG + Intronic
1015741324 6:136457341-136457363 TCTGGTCCTGAGCTTTTTTGGGG - Intronic
1018659824 6:166076014-166076036 CCTTTGCCTGAGTTTTGCTGAGG + Intergenic
1019829022 7:3307428-3307450 CCTATACCTGAGATCTGTTCTGG + Intronic
1021824936 7:24540443-24540465 CCTTTAGCTGAGGTCTGTTGGGG + Intergenic
1024492625 7:50002819-50002841 AATGTTCCTGAGCTTTGTTCTGG - Intronic
1026911222 7:74093022-74093044 CCTTTGCCTGGGCTTTGGTGCGG - Intronic
1027188457 7:75985060-75985082 GCTGTACCTGAGCTGGGTGGTGG + Exonic
1032265054 7:130364836-130364858 CCTGTCTCTGAGCTTTCTGGAGG - Intronic
1036693637 8:10960590-10960612 CCTGTGGCTGGGCTGTGTTGAGG - Intronic
1037591172 8:20313291-20313313 CCTGACCCTGAGTTTTGTTGCGG + Intergenic
1037970302 8:23166923-23166945 CCTGTACTTGAGTTTTTTTCTGG + Intergenic
1041837867 8:62237419-62237441 CCTGCACCTGGGTTTTTTTGTGG - Intergenic
1044524824 8:93240629-93240651 CCTTTGCCTGAGCTTTGCTTGGG + Intergenic
1049607450 8:143536317-143536339 CCTGTACCAGGCCCTTGTTGGGG + Exonic
1049850707 8:144828659-144828681 CCTGTACTTGAGCGCTGTCGTGG + Intronic
1052986321 9:34490732-34490754 GCTGGATCTGAGCTTTGTAGAGG + Intronic
1055248004 9:74270399-74270421 CAGGTACCTGTGCTTTGTTAAGG + Intergenic
1057064672 9:92037813-92037835 ACTGTCCCTGAGCTGTGCTGCGG + Intronic
1058925346 9:109657695-109657717 CCTCTACCTGAGCTTCTCTGAGG - Intronic
1061318291 9:129811688-129811710 CCTGAACCTGAGCTCAGGTGAGG + Intergenic
1061852609 9:133424758-133424780 GCTTTAGCTGAGCTTTGTGGGGG - Intronic
1062158120 9:135065415-135065437 CCTGGACCTGGGCTCTGTGGAGG + Intergenic
1062494770 9:136826534-136826556 CCTCCACCTGTGCTTTGTTGGGG + Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1203753694 Un_GL000218v1:104117-104139 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1203538111 Un_KI270743v1:61493-61515 CCTTTACCTGAGTTTTGCTTGGG - Intergenic
1197609401 X:128622317-128622339 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1200119003 X:153781657-153781679 CCTGTCCCTGGGCTTGCTTGGGG + Intronic
1201165563 Y:11205381-11205403 CCTTTACCTGTGCTTTGTTCGGG - Intergenic
1201167336 Y:11221676-11221698 CCTTTACCTGAGTTTTGCTTGGG + Intergenic
1201450758 Y:14111277-14111299 TCTGTATCTCATCTTTGTTGAGG + Intergenic