ID: 1176946684

View in Genome Browser
Species Human (GRCh38)
Location 21:14990611-14990633
Sequence TGAAATCTTAAAAGAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176946681_1176946684 12 Left 1176946681 21:14990576-14990598 CCAGAGGGCAACAGTAAGAAACA 0: 1
1: 0
2: 1
3: 18
4: 265
Right 1176946684 21:14990611-14990633 TGAAATCTTAAAAGAGATGCTGG 0: 1
1: 0
2: 3
3: 28
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176946684 Original CRISPR TGAAATCTTAAAAGAGATGC TGG Intronic
900267559 1:1766231-1766253 TGTAATTTTAATAGAGATGGGGG - Intronic
900807316 1:4775999-4776021 AAAAATCATAACAGAGATGCTGG - Intronic
901127530 1:6940084-6940106 TGAAATCTTCAACTAGGTGCTGG + Intronic
901735341 1:11308820-11308842 TGAAACCTCCAAATAGATGCTGG + Intergenic
902223654 1:14982731-14982753 TGAGATCTTGAAAGGGATCCAGG + Intronic
904512825 1:31027891-31027913 TGAAATATTAAAATCGATGTAGG + Intronic
905051984 1:35059805-35059827 TGAAAACTGCAAAGAGAGGCTGG - Exonic
906053787 1:42898416-42898438 TTAAATCTTGAAACAAATGCTGG - Intergenic
906655781 1:47547495-47547517 TGAAAGATAAAAAGAGATTCTGG + Intergenic
907167299 1:52425015-52425037 CTAGATCTTGAAAGAGATGCAGG - Intronic
907922606 1:58927734-58927756 TCACATCTGGAAAGAGATGCTGG + Intergenic
909831467 1:80196662-80196684 TGAAATCTTGAAAGAGGTGTGGG + Intergenic
909876429 1:80810231-80810253 TGCCATCTTAAAAGCAATGCTGG + Intergenic
910430243 1:87152876-87152898 TTAATGCTCAAAAGAGATGCTGG + Intronic
911112044 1:94199437-94199459 TGACATCTTAAAAAGCATGCTGG + Intronic
911664060 1:100534393-100534415 TGAAATCTTAAAAAGGAAGCTGG + Intergenic
911766773 1:101686195-101686217 TGGAATTTTAATAGAGATGGGGG + Intergenic
911888786 1:103340559-103340581 TGAAATCTAGAAAGAGATGCTGG + Intergenic
912533911 1:110348896-110348918 TAAAATGTTTAAAGAAATGCAGG - Intergenic
913361362 1:117984112-117984134 TGAAATTTTCATAGAAATGCAGG + Intronic
916329802 1:163602381-163602403 TGAAATCTAAATAGACATGAAGG - Intergenic
916494655 1:165335163-165335185 TGAAAGCTTAAAAGAGAGGAAGG - Intronic
917048333 1:170888992-170889014 TGAAAACTTAACAGAGAGACAGG - Intergenic
917164035 1:172091468-172091490 TGAAGACTTGAAAGAGATGTTGG + Intronic
918252262 1:182713478-182713500 TGCAATCATTAAAGAGAGGCCGG - Intergenic
918835890 1:189465490-189465512 TGAAAATGTAAAAGAGATGTTGG - Intergenic
918953989 1:191181309-191181331 TCACATCATAAAAGAGAAGCAGG - Intergenic
919578837 1:199345736-199345758 TGAAATGTTAAAAAAGAAGATGG - Intergenic
921568835 1:216754122-216754144 AGACATTTTAAAAGAGATGGAGG + Intronic
922129188 1:222759851-222759873 AGAAAGTTTAAAGGAGATGCTGG - Intergenic
923392181 1:233523375-233523397 TGAAATCTAAACTGAGTTGCTGG - Intergenic
1062779923 10:193674-193696 TGTAATCTTAATTGAGATGGTGG - Intronic
1063141719 10:3261692-3261714 TGAAATCATTAAAGGGATGTTGG + Intergenic
1063854265 10:10229954-10229976 TCAAATTTTAAAAGAAATGGAGG + Intergenic
1065616139 10:27525993-27526015 TGAACTCTTGAAAGACATGTGGG + Intronic
1065828995 10:29597383-29597405 AGAACTCTTAGAAGAGATCCAGG - Intronic
1066511761 10:36107109-36107131 TGAAATTTTAAAATAGATTTAGG + Intergenic
1066668625 10:37812990-37813012 GGAAATCATAAAAGAGATCGTGG + Intronic
1067239418 10:44477635-44477657 AGAAATCTGAATAGAAATGCTGG - Intergenic
1068341994 10:55716485-55716507 TGAAATCTTGAAAAAAATTCTGG - Intergenic
1069256556 10:66338578-66338600 TGAAAGCTTAATAGAGATTAGGG + Intronic
1071092177 10:81931425-81931447 AGAAGTCTTGAAAGAGATGGGGG + Intronic
1073242514 10:102067478-102067500 TGAAATCTTCAAACTGCTGCTGG + Exonic
1073763485 10:106656241-106656263 GGAAGTCTTAAAAAAGATGAAGG + Intronic
1079001836 11:16764224-16764246 TCAAATTTTAAAAGAGATAATGG + Intergenic
1079344982 11:19644182-19644204 TGAATTCCAGAAAGAGATGCTGG + Intronic
1080585564 11:33679048-33679070 TGTAATCATAAAAGTGATGCTGG + Intergenic
1081078533 11:38708721-38708743 TGAATTCTTACATAAGATGCTGG + Intergenic
1081652053 11:44830860-44830882 TGAAGTCTTTAAAAAGAAGCTGG + Intronic
1082575272 11:54795858-54795880 TAAAATCTTTTAAGAGATACTGG - Intergenic
1082988846 11:59190082-59190104 TTAATTCTTACAAGAGAAGCAGG + Intronic
1084454586 11:69261084-69261106 TTAAGTCTTAAAAGAGACACAGG - Intergenic
1086021225 11:82232223-82232245 TGAAAGATTGAAAGAGCTGCAGG + Intergenic
1086285572 11:85245929-85245951 CAAAATCTTAAAAGAGGTGAAGG - Intronic
1087340940 11:96906209-96906231 AAAAATCTTAAAAGACAGGCTGG + Intergenic
1090134183 11:124178855-124178877 TCAAATCTGTAAAGGGATGCTGG + Intergenic
1090523860 11:127507906-127507928 TAAGATTTTAAAAGAGAAGCAGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1093001613 12:14002952-14002974 TGATAACTAAAAAAAGATGCTGG - Intergenic
1093090749 12:14917567-14917589 TGAAGTCTTAAAAGACATTATGG + Intronic
1093740563 12:22680578-22680600 AGAAATCTGCCAAGAGATGCAGG - Intronic
1096404305 12:51332008-51332030 TAAAATTTTAATAGAGATGGGGG - Intronic
1096536191 12:52276584-52276606 TGAAAATATAAAAGAGGTGCTGG + Intronic
1097361747 12:58665994-58666016 TGATAGGATAAAAGAGATGCTGG + Intronic
1097702663 12:62836149-62836171 TGAAGGCTTTAAAGAAATGCTGG + Intronic
1098097961 12:66980301-66980323 TGAATTCTTAAAAGAGCATCTGG - Intergenic
1098627539 12:72691002-72691024 TAAAATCTTCAAACAGATGCAGG + Intergenic
1098667918 12:73187454-73187476 TGAAATCTTAAAATATAGCCTGG + Intergenic
1098802845 12:74984492-74984514 TGAAATCTGAGAAGACAAGCAGG - Intergenic
1099160562 12:79236335-79236357 TGAGTACTTAAAAGAGAGGCTGG - Intronic
1099960411 12:89391730-89391752 TGAAATCTTAATAGAAATATTGG - Intergenic
1100097967 12:91066959-91066981 TAAAATCTTTTAAAAGATGCTGG + Intergenic
1101176030 12:102152367-102152389 AGAAACCTTAAAAGAAATGTGGG - Intronic
1103491943 12:121328267-121328289 TGAATTCTTTAGAGAGAAGCAGG - Intronic
1103806591 12:123578476-123578498 TGAAATCAGAAAAGAGATAAAGG - Intergenic
1106225718 13:27785198-27785220 AAAAATCATAAAAGAGATCCAGG + Intergenic
1106623441 13:31393952-31393974 TGTATTCTTAATAGAGATGGGGG + Intergenic
1106994961 13:35470838-35470860 TGTAATCGTACAAGAGATTCGGG + Intronic
1107065365 13:36209084-36209106 GTAAATCTTCTAAGAGATGCTGG + Intronic
1107145697 13:37058773-37058795 AGAAATGTAAAAACAGATGCCGG - Intronic
1107275068 13:38668870-38668892 TGATATCTTAATAAAGCTGCTGG + Intergenic
1107539282 13:41371025-41371047 GGAAATCATAAAAGAGATTGTGG + Intronic
1108223582 13:48264296-48264318 TGGAATCTAAAAAGGGATACAGG - Exonic
1109801420 13:67383159-67383181 AATAATGTTAAAAGAGATGCAGG + Intergenic
1110191189 13:72730755-72730777 TGATATTTTAAAAGAGATACAGG + Intronic
1110885155 13:80623716-80623738 TGATGTCTTTAAAGAGAGGCCGG + Intergenic
1111231667 13:85352490-85352512 TTAAATCATTAAAGAGTTGCTGG + Intergenic
1111469245 13:88656222-88656244 TAAAATATTAAAACACATGCTGG - Intergenic
1112938828 13:104835030-104835052 TAAAATCTGAAAAGGGAGGCAGG + Intergenic
1113451483 13:110413293-110413315 TCAAATCCTGCAAGAGATGCCGG + Intronic
1113605749 13:111604134-111604156 TGAATTCGTAAAAAATATGCAGG - Intronic
1114293234 14:21306046-21306068 TGAAAGATTGAAAGAGATACTGG - Intronic
1115096521 14:29643622-29643644 TTAAATGTTTAAAGACATGCTGG - Intronic
1115949704 14:38706938-38706960 TGAAATCGTAAAGTAGATGCGGG - Intergenic
1117207213 14:53456037-53456059 TGAAAGATGAAAAGAGATGGGGG - Intergenic
1118445054 14:65843185-65843207 TGAAAACATAAAAGTCATGCTGG + Intergenic
1119503514 14:75151513-75151535 TGAAGTCTTAAAAAAAAGGCTGG - Intronic
1120637436 14:86969532-86969554 TGAAAGCTTTCATGAGATGCGGG - Intergenic
1120748180 14:88171913-88171935 TCAAATGTAAAAAGAAATGCTGG + Intergenic
1121072875 14:91040565-91040587 TGAAAACCTGAAAGAGATGTAGG + Intronic
1121911680 14:97797587-97797609 TTGAATCTTCAAATAGATGCTGG + Intergenic
1124037136 15:26064724-26064746 TGTAATATTAAAAGAAATCCAGG - Intergenic
1124236213 15:27991437-27991459 TGAATGCTTAGAAGTGATGCTGG + Intronic
1125056813 15:35369126-35369148 GGAAATTTTCAAAGAGATGGTGG + Intronic
1125158007 15:36611554-36611576 TTTCATCTCAAAAGAGATGCAGG - Intronic
1126250601 15:46563951-46563973 TGACATATTAAAAGTGATGAAGG - Intergenic
1126743557 15:51802076-51802098 TCAAATCCAAAAAAAGATGCAGG + Intronic
1127183729 15:56454771-56454793 TGAGAATTTAAAAGAGATACGGG - Intronic
1127693094 15:61416579-61416601 TGTAAACTTAAGAGAGATGATGG - Intergenic
1128447988 15:67781802-67781824 TCAAATTTAGAAAGAGATGCAGG - Intronic
1130752755 15:86730166-86730188 TGAAATCTTATAAGAAAACCTGG + Intronic
1130774116 15:86959985-86960007 CGAAACCTTAAAAGAGTTGGTGG - Intronic
1133783488 16:8957144-8957166 TGAAATTTTTGAAGAGAAGCAGG - Intronic
1135609983 16:23857814-23857836 TGAAATCTTTGAAGACATCCAGG - Intronic
1138137316 16:54534484-54534506 TGAAATCTTAAAAGGGGAGTCGG - Intergenic
1140530940 16:75665486-75665508 TGAAATCTTGAAATAAATCCTGG + Intronic
1140851925 16:78943230-78943252 TTTAATCTTAAAAAAGATCCCGG + Intronic
1141109181 16:81257974-81257996 TGTAATCTCAAGAGAGAAGCAGG + Intronic
1141969447 16:87470733-87470755 TGCAGTCTTAAAAGGCATGCAGG + Intronic
1144512320 17:15887649-15887671 TTAAATTTTAAAAGATAGGCTGG + Intergenic
1144600643 17:16609625-16609647 TGAAATATTAGAAGTCATGCAGG + Intergenic
1146060306 17:29601814-29601836 TGAAATCTTTAAAGTGCTGGGGG - Intronic
1146789714 17:35744484-35744506 TGAAATTTGAAAAAAGAAGCTGG + Intronic
1151609476 17:75162683-75162705 AGAAATCCTAAAAGTGAGGCCGG + Intronic
1151895735 17:76979624-76979646 TGAAATTTTAAAATAGAAACAGG + Intergenic
1153835432 18:8959655-8959677 TGAAATATTGAAAGAGATAACGG + Intergenic
1155576613 18:27254730-27254752 GGAAAACTTAAAAGAGAAGAGGG + Intergenic
1156123365 18:33872695-33872717 TGAAAACTTGAAATAGATCCCGG + Intronic
1156208623 18:34913722-34913744 TGACTTCTTAAAAGAGGTGAAGG - Intergenic
1158282909 18:55847553-55847575 TAAAAACTTAGAATAGATGCAGG - Intergenic
1158357740 18:56639298-56639320 TTGAATCTTTAAAGAGAAGCAGG + Intronic
1159313022 18:66734919-66734941 TGTAAACTTAAAATAAATGCTGG - Intergenic
1159452157 18:68616325-68616347 TGAAAGACTAAAAGAGATACAGG + Intergenic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
1161463502 19:4413480-4413502 TGCAATCTGGAAAGAGCTGCTGG - Intronic
1162858031 19:13484097-13484119 TGAAATCATACAAAAGATGTTGG - Intronic
1164426781 19:28148625-28148647 TGAAATCTTAATGAAGAAGCTGG - Intergenic
1164953005 19:32354645-32354667 TGACATTTTGAAAGAGTTGCAGG + Exonic
1168210361 19:54885801-54885823 TGAAATCTTGAATGGGATCCTGG - Intronic
925781323 2:7384696-7384718 TGAAAAATTAAAAAAGATTCTGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926820897 2:16850724-16850746 AGAAATCAAAAAAGAGACGCCGG - Intergenic
927264797 2:21133524-21133546 TGAAATCTAAAAAGAGATTTAGG - Intronic
928202128 2:29254460-29254482 TGAAATATTCCCAGAGATGCTGG + Intronic
928783771 2:34856293-34856315 TGACATATTTAAAGAGATGAAGG + Intergenic
929845667 2:45523007-45523029 TGAAATCTTAAAAAAACTTCTGG + Intronic
930636082 2:53807156-53807178 TTAAATCTAAAGAGAGAAGCAGG - Intronic
931924425 2:67055778-67055800 AGAAATCTGGAAAGATATGCTGG - Intergenic
932163975 2:69489153-69489175 TAAAATATCAAAAGAGAAGCCGG + Intronic
932819898 2:74890703-74890725 TGAAAGCTAAGAAGCGATGCTGG - Intronic
935040326 2:99420249-99420271 TGAAATCTTAAAAATCCTGCTGG + Intronic
935263445 2:101374870-101374892 TGAAAAGTAAAAAGAGATTCTGG - Intronic
936056867 2:109268160-109268182 TGTGATGTTAAAAGAGATGGAGG + Intronic
936850320 2:116888884-116888906 TGAAATCTAAAAACAGAAGTAGG - Intergenic
937716797 2:125040887-125040909 TTAAATCTTAAAAAAGATCATGG + Intergenic
937855370 2:126668639-126668661 TGAAATGTTAAAAAAGAGACTGG + Intronic
939370488 2:141292824-141292846 TGAAATCCTACATGAGATCCTGG + Intronic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939600677 2:144186159-144186181 TGATATCTTTCAAGAGATGAAGG - Intronic
939761711 2:146190644-146190666 AGAAATCTGAGAAGAGATCCAGG - Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940504988 2:154542028-154542050 ACAAATCTTAAAAGACATGAGGG + Intergenic
940740959 2:157507128-157507150 TGAAAACTTAAAAGAGATCAAGG - Intergenic
940760805 2:157737227-157737249 AGAAATCCTAAAAGAGATCTGGG - Exonic
940866403 2:158821925-158821947 TGAAATCTTTAAAGAGGAGCAGG - Intronic
941308185 2:163896655-163896677 AGAAATTTAAAAAGAGATGTGGG - Intergenic
943369354 2:186998209-186998231 TGAAATGTGAAAACATATGCGGG + Intergenic
943478019 2:188383669-188383691 TGGAATTTTAAAAGATATGCTGG + Intronic
944123360 2:196265757-196265779 TTTAATCTTCAAAAAGATGCTGG + Intronic
945416650 2:209581536-209581558 TGAAATCTAAAAAGAGAGAATGG - Intronic
945515272 2:210756174-210756196 TCATTTCATAAAAGAGATGCTGG - Intergenic
945613298 2:212033294-212033316 TGGGATCTCAAAAGAGAAGCTGG + Intronic
945917381 2:215718199-215718221 TGAAGTCTCCAAAGAGCTGCTGG - Intergenic
946070703 2:217032182-217032204 TGAAATCCTTAAAGGGTTGCTGG + Intergenic
947414641 2:229881680-229881702 TTAAACATTAAAAGAGAGGCAGG + Intronic
947776721 2:232717901-232717923 TGAAATCTGATCACAGATGCTGG - Intronic
948579890 2:238979328-238979350 TGAGTTCTTAGAAGATATGCGGG + Intergenic
1168786204 20:542724-542746 TGAAAACTAAGAAGAGAGGCCGG - Intronic
1169452435 20:5723515-5723537 TTAAATTTTAAAAAAGAGGCCGG + Intergenic
1169961403 20:11164177-11164199 GTAAATCTTAAAAGAAAAGCAGG - Intergenic
1170773883 20:19358476-19358498 TGAAAGCTCAAGAAAGATGCAGG - Intronic
1172514254 20:35522233-35522255 TGAAATCTAAAAAGAAATTGAGG + Intergenic
1173215078 20:41073651-41073673 TGCAATGTTAAAAGAAAAGCTGG - Intronic
1173347715 20:42216127-42216149 TGAGATCTGAGAAGAGATGTGGG - Intronic
1173702813 20:45088054-45088076 TGCAAACTTAAAACAAATGCTGG + Intergenic
1174628321 20:51934531-51934553 TAAAATAGGAAAAGAGATGCTGG - Intergenic
1176946684 21:14990611-14990633 TGAAATCTTAAAAGAGATGCTGG + Intronic
1177578737 21:22992782-22992804 TGAAAGCTTAAAGGAGATTAAGG - Intergenic
1178329726 21:31677391-31677413 TGATACCTGAAAGGAGATGCAGG - Intronic
1178986584 21:37309886-37309908 TGAAATCTTAAAAGCCAAGGGGG + Intergenic
1179711303 21:43264804-43264826 TGACATCTTAAAAGTCTTGCTGG - Intergenic
1179776798 21:43669488-43669510 GCAAATCTTACAAGAGATGCGGG - Intronic
1182191403 22:28464487-28464509 AGAAATCATAAAAGATATGCAGG - Intronic
1182935057 22:34213382-34213404 TAAAATATTCAAAGAGATGAGGG - Intergenic
949381982 3:3456814-3456836 TGAAGTGTTAAAAGAGATTTAGG + Intergenic
950315804 3:12001251-12001273 TGCAATCTAAAAAGAGAAGCTGG + Intergenic
950383521 3:12637513-12637535 TCAAATGTTAATAGAGATGGAGG - Intronic
950739967 3:15042690-15042712 TGAAATCAGAAAAGAGAGGTGGG + Intronic
951755770 3:26089291-26089313 AGAAATCATAAGAGAGATGATGG + Intergenic
951949963 3:28189129-28189151 GGAAATCATGAAAGAGATTCTGG + Intergenic
953152198 3:40334671-40334693 TCCAATTTTTAAAGAGATGCTGG + Intergenic
953379632 3:42458822-42458844 GGAAATCATAAAAGAGATTGTGG - Intergenic
954968612 3:54633131-54633153 TGAAACCCTAAAAGGGATGGAGG + Intronic
955485377 3:59429618-59429640 GGAACTCTTCAAAGAGATGAGGG - Intergenic
955756407 3:62229170-62229192 TGAGATGCTAAAAGAGATGGGGG + Intronic
956310103 3:67869372-67869394 TGAAATCTTTGAAGAAAGGCTGG + Intergenic
957495750 3:80989476-80989498 TAAAATCTTTAAAGAGATGGAGG + Intergenic
957783974 3:84856508-84856530 TTAAATCTTTAAAGATATTCTGG - Intergenic
958136880 3:89505183-89505205 TGAAATCTTCAGAGAGATTTTGG + Intergenic
959304092 3:104637587-104637609 TGAAATATTAAAAGTGCTGAAGG + Intergenic
961558927 3:127715540-127715562 ACAAATCTTAAAAGAGCAGCAGG - Intronic
963544074 3:146632713-146632735 AGAAATCTTAAATGAGATGATGG - Intergenic
964654367 3:159050676-159050698 GAAAATATAAAAAGAGATGCAGG + Intronic
965073371 3:163944213-163944235 TGAAATCTTATATCAGCTGCTGG + Intergenic
965373524 3:167893687-167893709 TGAAAGCTGAAAGGAGAAGCGGG + Intergenic
965455325 3:168892634-168892656 TGAATTCTTGGAAGAGATTCTGG - Intergenic
965467016 3:169042309-169042331 TGAACTTTTAAAAAAGATTCAGG - Intergenic
967591988 3:191288220-191288242 TGGAATTTTAAAAGAGATTGCGG - Intronic
967848466 3:194063553-194063575 TGAATTCCAAAGAGAGATGCTGG + Intergenic
972304214 4:37816418-37816440 TGTACTCTTAAAAGAAATACTGG - Intergenic
972506842 4:39727834-39727856 TGAAATCTTAGAAGTGAGCCGGG + Intronic
972810288 4:42577332-42577354 AGAAATCTAAAATGAGCTGCAGG - Intronic
972939176 4:44176409-44176431 TGAAATCTTAAATGACCTGATGG - Intronic
973162780 4:47039114-47039136 TGAAATCTTATAAAAAAGGCTGG + Intronic
973532516 4:51847085-51847107 CCATATCTTACAAGAGATGCTGG - Intronic
973669792 4:53204857-53204879 AGAAATCTCAAAAGCAATGCTGG + Intronic
975093206 4:70426875-70426897 TGAAATGTTAAAAGATGTGGTGG - Intergenic
976029133 4:80729902-80729924 TTAAATTTAAAAATAGATGCTGG - Intronic
976681178 4:87757858-87757880 TGAGATATTAAAACAGATGCTGG - Intergenic
976788399 4:88849091-88849113 TGAAATCATAAATAAGATTCAGG - Intronic
977350797 4:95884482-95884504 TGAAATCTTAAAAAATATTCAGG - Intergenic
977968196 4:103180349-103180371 TGAAAACTTAACACGGATGCTGG - Exonic
978211045 4:106135454-106135476 TGGAATCTTACAAGAGAGGCAGG - Intronic
979902785 4:126244581-126244603 TTTAATTATAAAAGAGATGCTGG - Intergenic
980544999 4:134248234-134248256 TGAAATTTTAAAACATGTGCAGG - Intergenic
980897593 4:138874910-138874932 GGAAATCTTAAAAGATCTGTAGG + Intergenic
981121782 4:141059519-141059541 TGAATTCTAAAAAAAAATGCAGG - Intronic
981136523 4:141216863-141216885 AGAAATCTTAAAATAGAGGCAGG - Intergenic
981319311 4:143373172-143373194 TGACATTTTAATAGAGATGCTGG - Intronic
981545009 4:145884554-145884576 TTAAATTTTAAAGGAGATGTAGG - Intronic
981809746 4:148760268-148760290 TGAAATCATGAAAGAGATTGTGG - Intergenic
981841425 4:149117097-149117119 TGAAGTCTTCAAAAAGTTGCTGG + Intergenic
983039669 4:162910528-162910550 GGAAATCATGAAAGAGATGGTGG + Intergenic
983350851 4:166586448-166586470 TGAAATCTTAAGATAGACACTGG - Intergenic
983650056 4:170028122-170028144 TGAGAATTTAAAAGAGATGGGGG - Intronic
984369742 4:178847411-178847433 TGATATCTTATTAGAGATGGAGG + Intergenic
984480201 4:180291115-180291137 TGAAATCTCTAATGAGATGGAGG + Intergenic
987259631 5:16190155-16190177 TTAAATTTTAAAAGACTTGCAGG + Intergenic
987368979 5:17175773-17175795 TGGAACCTTAAAAGAACTGCGGG - Intronic
989629481 5:43466344-43466366 TGACATCTTAAAAGTGCTGAAGG + Intronic
989646365 5:43637420-43637442 TGAAATGCTAAAAGAGATTTTGG + Intronic
989726394 5:44591454-44591476 TGAAATCTAATAACAGTTGCTGG + Intergenic
990599232 5:57340583-57340605 TTAGATCTTAAAAGTAATGCAGG + Intergenic
993254682 5:85574719-85574741 TGAAATGATTAAATAGATGCAGG - Intergenic
993349415 5:86829768-86829790 CAAAATCTTAAAAGAGATAAAGG - Intergenic
994955089 5:106519434-106519456 TGAAATGTTCGCAGAGATGCAGG + Intergenic
995428831 5:112051883-112051905 AGAAATCTAAAAAGAGATATAGG + Intergenic
995924305 5:117351955-117351977 TCAAACCTTAAAAGAAATACCGG - Intergenic
996514272 5:124352507-124352529 TGAAAGCTTGAATGAGATTCAGG - Intergenic
998728832 5:145050492-145050514 TGTAAAATTAAAAGAGAAGCAGG + Intergenic
999013121 5:148065014-148065036 TGTAATTTTAAAAGGGAGGCTGG + Intronic
999678104 5:154027329-154027351 TAAAACCTAAAAAGAGATGGAGG + Exonic
1001148233 5:169203570-169203592 GAAAATCTCAAAAGAGATCCAGG - Intronic
1001478614 5:172069945-172069967 TGAAATCTTAAAAAATATATGGG + Intronic
1002982009 6:2147213-2147235 TGAAACCTTAAAAAAGTTACCGG + Intronic
1003108375 6:3232307-3232329 AGAAATTTTAAAAAAGAAGCAGG - Intronic
1005477714 6:26224442-26224464 TAAAATCTTGAAAAAGATGGCGG - Intergenic
1005768960 6:29045569-29045591 TGAAAGTTTGAAATAGATGCTGG + Intergenic
1006430575 6:33993269-33993291 TGAGGTCTTAAAAGATAGGCAGG + Intergenic
1008802468 6:55386565-55386587 TCAAATCTTGAGAGAGATGAGGG - Intronic
1011553419 6:88550272-88550294 TTAAATCTGAAAAGAAATGTGGG - Intergenic
1011652641 6:89521032-89521054 TGGAATTTTAAAAGAATTGCAGG + Intronic
1013090515 6:106896430-106896452 TGATATTTTAAAAGAGATGCTGG + Intergenic
1013574719 6:111470677-111470699 TAAAAAATTAAAAGACATGCCGG + Intronic
1014074849 6:117224169-117224191 TGAATTCCTAAAAGATACGCAGG + Intergenic
1014124849 6:117765032-117765054 TGAAAAGTCAAAACAGATGCTGG + Intergenic
1014636677 6:123855979-123856001 TAAAATCTTAAAAGATATTGTGG - Intronic
1014877643 6:126680458-126680480 AGAAATCTTAAAAGATATTCAGG + Intergenic
1015274059 6:131366451-131366473 TGAAGTCTGGAAAGAAATGCAGG - Intergenic
1015721647 6:136249063-136249085 GAATATCTTAAGAGAGATGCTGG - Exonic
1015940406 6:138445503-138445525 TTAAATCTTAAAAGAATAGCAGG - Intronic
1017118857 6:151005032-151005054 ACAAAGCTTAAAAGAGATACAGG - Intronic
1018152607 6:160954517-160954539 GGAAGTCTTGAAAGAGATGAGGG - Intergenic
1020178320 7:5900414-5900436 TGAATTCTTAAAACTGCTGCTGG + Intronic
1020304606 7:6824585-6824607 TGAATTCTTAAAACTGCTGCTGG - Intronic
1020413686 7:7921442-7921464 TGACATTTTAAAAGAGCTGTAGG - Intronic
1021656973 7:22882270-22882292 TGGAATCATTAAAGAGATCCTGG + Intergenic
1023386675 7:39664777-39664799 GGAAATCTTGAAAGAGTTGGTGG + Intronic
1024020415 7:45363298-45363320 GGAAATCTTGAAAGTGATCCAGG - Intergenic
1024561619 7:50649607-50649629 AGAAATCATACAAGAGCTGCTGG + Intronic
1027643907 7:80772115-80772137 TGAATGCTTAATAGAGATGAGGG + Intronic
1028305541 7:89259344-89259366 GGAAATCATAAAAGAGATTGTGG - Intronic
1029080489 7:97970264-97970286 TGAATTCTTAAAACTGCTGCTGG - Intergenic
1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG + Intergenic
1031058454 7:117020949-117020971 TTAAACCTTAAAATAGATACTGG + Intronic
1031064812 7:117093526-117093548 TGAAGTTTTAGTAGAGATGCGGG - Intronic
1031074569 7:117200200-117200222 TGAAACCTTAAAGTAGATGTAGG + Intronic
1033440866 7:141377441-141377463 TGATTTCTTAAAATAGAAGCAGG - Intronic
1036097740 8:5742024-5742046 TGAGATCATGAAAGACATGCAGG - Intergenic
1038342908 8:26702840-26702862 TAACATATTAAAAGAAATGCTGG - Intergenic
1039918868 8:41879083-41879105 TGAAAAATTAAAAAAAATGCAGG + Intronic
1040342900 8:46451319-46451341 AGAAATCTGAAAAGAGATTTCGG - Intergenic
1040719968 8:50307933-50307955 TGAAATGTTAGAACAGATCCAGG - Intronic
1041212125 8:55563042-55563064 TAAAAACTGAAAAGAAATGCTGG - Intergenic
1042432232 8:68721021-68721043 TGAAATTATAAAAGAGAAACAGG + Intronic
1042452501 8:68964988-68965010 TAAAATCTTAAAAGAGTTTTTGG + Intergenic
1042507543 8:69576971-69576993 TTCACTTTTAAAAGAGATGCAGG - Intronic
1042889082 8:73587131-73587153 TGAAATTTTAACAGCAATGCTGG + Intronic
1043245749 8:77998637-77998659 TGAAACCTTTAAAGACATGGAGG + Intergenic
1043423132 8:80120905-80120927 TGAAATTTTATTAGAGATGGGGG - Intronic
1043624539 8:82239744-82239766 TAAAATTTTAAAACAAATGCAGG - Intergenic
1043801370 8:84614826-84614848 TAAAATCTTATAAAATATGCTGG + Intronic
1044734531 8:95266502-95266524 TTAACTCTTATAAGAGATACAGG + Intronic
1046270393 8:111889104-111889126 GGAAATCATAAAAGAGATTATGG - Intergenic
1046541837 8:115593721-115593743 TGAAAACTTCAAAGACATTCAGG + Intronic
1048465646 8:134662714-134662736 TGTAATTTTAATATAGATGCTGG - Intronic
1048845460 8:138600683-138600705 TGAAATATTAAAAGCAATACAGG - Intronic
1050223663 9:3425391-3425413 TCAAATCATAAAAGTAATGCAGG - Intronic
1051505216 9:17819354-17819376 TGAAATCTTAAAAAAAATTCTGG + Intergenic
1051535456 9:18152459-18152481 TGAGAGCTTAAAAGAATTGCAGG + Intergenic
1051720767 9:20034762-20034784 TTAAATCTTAAAAGGCAGGCCGG - Intergenic
1051812444 9:21065683-21065705 TGTTATATTCAAAGAGATGCTGG + Intergenic
1051881304 9:21842243-21842265 TGAAATTTTAAAAGAAATTTGGG + Intronic
1055353606 9:75414708-75414730 TGAAATCCTAAAAGGGATGGTGG + Intergenic
1055900710 9:81232023-81232045 TAAAATTTTTAAAGAGATACAGG + Intergenic
1056081569 9:83099964-83099986 TGATATCTTAAATAAGATGATGG - Intergenic
1056740699 9:89251947-89251969 TGAGACTTTAAAAGAGAAGCTGG - Intergenic
1057012887 9:91621914-91621936 AGAAATTTTAAAAAAGAGGCTGG + Intronic
1058922087 9:109626899-109626921 TGAAAAATTAAAAGGGAAGCAGG + Intergenic
1059054663 9:110966759-110966781 TGAAAACCTAAAAGATATTCAGG - Intronic
1059290538 9:113220409-113220431 AGAAATCTTTAAAGAGAGGAAGG - Intronic
1061840186 9:133354168-133354190 TGAAATTTTAAAAAATATGTGGG + Intronic
1062195772 9:135273179-135273201 TTAAATATTTAAAGAGATGCTGG + Intergenic
1062305621 9:135905433-135905455 TAAAATCTTAAAAAACATGCAGG + Intronic
1062411587 9:136428289-136428311 TGTAATTTTAGTAGAGATGCAGG + Intergenic
1185987645 X:4853619-4853641 TGTAATTTGAAAAGAGATGGTGG + Intergenic
1186221101 X:7350081-7350103 TGAAATCCTCAAAGTCATGCAGG + Exonic
1186235756 X:7507730-7507752 TGAAATCTAAAAGTAGATTCAGG - Intergenic
1186265555 X:7829629-7829651 TTAAATGTTAAAAGAGAAGGTGG - Intergenic
1187709996 X:22043695-22043717 TTAAATCTAAAAACAGAGGCTGG + Intronic
1187802824 X:23082947-23082969 TCAAATTTTTAAAGAGATGAAGG + Intergenic
1188122396 X:26324720-26324742 TGAAATTTTAAAAAAGATATAGG - Intergenic
1188561883 X:31477881-31477903 TGAAATATTAAAACAGTTACAGG - Intronic
1189795085 X:44638336-44638358 TGAAACCTTATGAGAGATACTGG - Intergenic
1190021566 X:46882923-46882945 TGAATTTTTAATAGAGATGATGG + Intergenic
1190781111 X:53596019-53596041 TGAAATATTTAAAGAGAAGCTGG - Intronic
1191007971 X:55730927-55730949 TGAAATCTAAAGAGACAAGCAGG + Intronic
1192082908 X:68065544-68065566 TAAAATGTTAAAAGAAATGCAGG + Intronic
1194933703 X:99920899-99920921 TGCAATTTTGAAAGAGAGGCAGG + Intergenic
1196504917 X:116430240-116430262 TGACATCTTAAGAGATATTCTGG - Intergenic
1197071978 X:122310188-122310210 TTAAATTTTAAAAAAAATGCTGG - Intergenic
1197867787 X:131036833-131036855 TGAAATCTGAAAAGTGGTGGTGG + Intergenic
1197876354 X:131112902-131112924 TGACATATTTAAAGAGATGAAGG - Intergenic
1200800778 Y:7385549-7385571 TAAGATATTAAAACAGATGCAGG - Intergenic